Stem-loop ath-MIR319a

Accession

MI0000544

Description

Arabidopsis thaliana ath-MIR319a precursor miRNA

Literature search

45 open access papers mention ath-MIR319a
(315 sentences)

Sequence

agagagagcuuccuugaguccauucacaggucgugauaugauucaauuagcuuccgacucauucauccaaauaccgagucgccaaaauucaaacuagacucguuaaaugaaugaaugaugcgguagacaaauuggaucauugauucucuuugaUUGGACUGAAGGGAGCUCCCUcu
((((.((((((((((.((((((.(((.(((..((.(.(((((((((((.(((.(((..((((((((.((..((.((((((................)))))).))..)).))))))))..))).)).).)))))))))))).))..))).))).)))))).)))))))))).))))

Structure

    a          g      u   c   uc  g u           a -  u   ac        c  aa  c      gccaaaa 
agag gagcuuccuu agucca uca agg  gu a augauucaauu g cu ccg  ucauucau ca  ua cgaguc       u
|||| |||||||||| |||||| ||| |||  || | ||||||||||| | || |||  |||||||| ||  || ||||||        
ucUC CUCGAGGGAA UCAGGU agu ucu  ua u uacuagguuaa c ga ggc  aguaagua gu  au gcucag       u
    C          G      U   u   cu  g -           a a  u   gu        a  aa  u      aucaaac 

Annotation confidence Not enough data

Comments

The A. thaliana jaw-D mutant has crinkly leaves and fruits, delayed flowering time and greenish petals. The jaw-D phenotype is caused by the over-expression of miR319 (also therefore known as miR-JAW), which is produced from a ~500 base long primary transcript RNA [1]. The mir-JAW microRNA is expressed in two forms, 20 and 21 nt, differing by the presence of the 3' terminal U. Cloned microRNA sequence was obtained from the jaw-D mutant. This miR has been shown targets TCP genes for cleavage [1]. This sequence is located on BAC F9D16. miR-JAW has a homologue located in BAC MBK23 (MIR:MI0000545). The mature excised miR shows sequence similarity to miR159 (MIR:MI0000189, MIR:MI0000218).

Genome context

chr4: 12352956-12353131 [+]

Mature ath-miR319a

• Accession: MIMAT0000511
• Description: Arabidopsis thaliana ath-miR319a mature miRNA
• Sequence: 154 - UUGGACUGAAGGGAGCUCCCU - 174
• Evidence: experimental ; Northern [1], 5'RACE [2], cloned [2], 454 [3], Illumina [5]

References

1. PubMed ID: 16040653
   Expression of Arabidopsis MIRNA genes
   "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
   "Plant Physiol (2005) 138:2145-2154


2. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


3. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


4. PubMed ID: 19815687
   Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
   "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
   "J Exp Bot (2010) 61:165-177


5. PubMed ID: 12931144
   Control of leaf morphogenesis by microRNAs
   "Palatnik JF, Allen E, Wu X, Schommer C, Schwab R, Carrington JC, Weigel D"
   "Nature (2003) 425:257-263