miRBase entry: ath-MIR319b

Stem-loop ath-MIR319b


Accession
MI0000545
Description
Arabidopsis thaliana ath-MIR319b precursor miRNA
Gene family
MIPF0000010; MIR159

Literature search
35 open access papers mention ath-MIR319b
(280 sentences)

Sequence

agagagcuuucuucgguccacucauggaguaauaugugagauuuaauugacucucgacucauucauccaaauaccaaaugaaagaauuuguucucauaugguaaaugaaugaaugaugcgagagacaaauugagucuucacuucucuaugcUUGGACUGAAGGGAGCUCCCU
((.(((((((((((((((((..(((((((......(((((((((((((..((((((..((((((((.((..(((((.((((..(((....))))))).)))))..)).))))))))..))))))...))))))))).))))..)))))))..))))))))))))))))).))

Structure
  a                 cu       uaauau    -         -ga      ac        c  aa     a    aa   u 
ag gagcuuucuucggucca  cauggag      guga gauuuaauu   cucucg  ucauucau ca  uacca auga  gaa u
|| |||||||||||||||||  |||||||      |||| |||||||||   ||||||  |||||||| ||  ||||| ||||  |||  
UC CUCGAGGGAAGUCAGGU  guaucuc      cacu cugaguuaa   gagagc  aguaagua gu  auggu uacu  cuu u
  C                 Uc       ----uu    u         aca      gu        a  aa     a    --   g 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This sequence is a homologue of miR319a (MIR:MI0000544) -- also called miR-JAW -- and is located on BAC MBK23.

Genome context
chr5: 16660469-16660640 [-]

Database links

Mature ath-miR319b

Accession MIMAT0000512
Description Arabidopsis thaliana ath-miR319b mature miRNA
Sequence 152 - UUGGACUGAAGGGAGCUCCCU - 172
Evidence experimental
Northern [1], 5'RACE [2], cloned [2], 454 [3], Illumina [5]

References

  1. PubMed ID: 16040653
    Expression of Arabidopsis MIRNA genes
    "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
    "Plant Physiol (2005) 138:2145-2154

  2. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  3. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  4. PubMed ID: 19815687
    Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
    "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
    "J Exp Bot (2010) 61:165-177

  5. PubMed ID: 12931144
    Control of leaf morphogenesis by microRNAs
    "Palatnik JF, Allen E, Wu X, Schommer C, Schwab R, Carrington JC, Weigel D"
    "Nature (2003) 425:257-263