miRBase entry: mmu-mir-30c-1

Stem-loop mmu-mir-30c-1


Accession
MI0000547
Symbol
MGI: Mir30c-1
Description
Mus musculus mmu-mir-30c-1 precursor miRNA

Literature search
211 open access papers mention mmu-mir-30c-1
(1294 sentences)

Sequence

495290 reads, 1771 reads per million, 107 experiments
accauguuguagugugUGUAAACAUCCUACACUCUCAGCugugagcucaagguggCUGGGAGAGGGUUGUUUACUCCuucugccaugga
.(((((..((((...(.(((((((.(((...(((((((((....(((...)))))))))))).))).))))))).)...))))))))).

Structure
a     uu    ugu U       U   ACA         guga   c 
 ccaug  guag   g GUAAACA CCU   CUCUCAGCu    gcu  
 |||||  ||||   | ||||||| |||   |||||||||    ||| a
 gguac  cguc   C CAUUUGU GGG   GAGGGUCgg    ugg  
a     --    uuC U       U   --A         ----   a 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr4: 120769534-120769622 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from mmu-mir-30c-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-30c-5p

Accession MIMAT0000514
Description Mus musculus mmu-miR-30c-5p mature miRNA
Sequence 17 - UGUAAACAUCCUACACUCUCAGC - 39
Evidence experimental
cloned [1-4], Illumina [5-6]
Database links
Predicted targets

Mature mmu-miR-30c-1-3p

Accession MIMAT0004616
Description Mus musculus mmu-miR-30c-1-3p mature miRNA
Sequence 56 - CUGGGAGAGGGUUGUUUACUCC - 77
Evidence experimental
cloned [4], Illumina [5-6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  5. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  6. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009