miRBase entry: mmu-mir-15a

Stem-loop mmu-mir-15a


Accession
MI0000564
Symbol
MGI: Mir15a
Description
Mus musculus mmu-mir-15a precursor miRNA mir-15
Gene
family?
RF00455; mir-15

Literature search
198 open access papers mention mmu-mir-15a
(736 sentences)

Sequence

193105 reads, 1527 reads per million, 107 experiments
cccuuggaguaaagUAGCAGCACAUAAUGGUUUGUGgauguugaaaaggugCAGGCCAUACUGUGCUGCCUCAaaauacaagga
.(((((.......(..((((((((..((((((((((.............))))))))))..))))))))..)......))))).

Structure
c     gaguaaa UA        UA          gaugu 
 ccuug       g  GCAGCACA  AUGGUUUGUG     u
 |||||       |  ||||||||  ||||||||||     g
 ggaac       C  CGUCGUGU  UACCGGACgu     a
a     -auaaaA UC        CA          ggaaa 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 61632027-61632110 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-15a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-15a-5p

Accession MIMAT0000526
Description Mus musculus mmu-miR-15a-5p mature miRNA
Sequence 15 - UAGCAGCACAUAAUGGUUUGUG - 36
Evidence experimental
cloned [1,3-5], Northern [2], Illumina [6-7]
Database links
Predicted targets

Mature mmu-miR-15a-3p

Accession MIMAT0004624
Description Mus musculus mmu-miR-15a-3p mature miRNA
Sequence 52 - CAGGCCAUACUGUGCUGCCUCA - 73
Evidence experimental
cloned [5], Illumina [6-7]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  4. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  5. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  6. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  7. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009