Stem-loop mmu-mir-31

Accession

MI0000579

Symbol

MGI: Mir31

Description

Mus musculus mmu-mir-31 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

Mmu-mir-31 is a microRNA that is expressed in mice and is upregulated in response to M. bovis BCG infection [PMC4097432]. It has been found to have different isoforms, such as hsa-miR-31, ptr-miR-31, and mmu-mir-31, which have slight variations in their sequences [PMC3759948]. Mmu-mir-31 is one of the top miRNAs enriched in the mammary glands of pubertal mice and is expressed in all stages of development [PMC8944794]. It has been studied using microRNA real-time PCR amplification with TaqMan assays [PMC3510057]. Mmu-mir-31 has been used to generate transgenic mice for research purposes [PMC5648844]. The transcription start site for mmu-mir-31 has been determined using RNA sequencing data [PMC6291424]. The expression of mmu-mir-31 has been found to be upregulated in certain cells, such as Th1 cells and CD8+ T cells, and it plays a role in T cell dysfunction and exhaustion [PMC8602903]. Mmu-mir-31 has also been studied in the context of obesity, but its expression was not consistently found to be downregulated [PMC6001404][PMC3742134[PMC3742134]. It has been shown to regulate the expression of various target genes involved in different biological processes [PMC3742134][PMC4077261][PMC7926522][PMC8602903][PMC3692539[PMC4077261][PMC7926522][PMC8602903][PMC3692539].

Literature search

143 open access papers mention mmu-mir-31
(1159 sentences)

Sequence

128056 reads, 615 reads per million, 102 experiments

ugcuccuguaacucggaacuggagaggAGGCAAGAUGCUGGCAUAGCUGuugaacugagaaccUGCUAUGCCAACAUAUUGCCAUCuuuccugucugacagcagcu
.(((.(((....(((((.(.(((((((.(((((.(((.(((((((((.(((........)))..))))))))).))).))))).))))))).))))))))).))).

Structure

u   c   uaac     a u       A     G   C         -U   gaa 
 gcu cug    ucgga c ggagagg GGCAA AUG UGGCAUAGC  Guu   c
 ||| |||    ||||| | ||||||| ||||| ||| |||||||||  |||    
 cga gac    agucu g ccuuuCU CCGUU UAC ACCGUAUCG  caa   u
u   c   ----     - u       A     A   A         Uc   gag 

Annotation confidence High

Genome context

chr4: 88910557-88910662 [-]

Mature mmu-miR-31-5p

• Accession: MIMAT0000538
• Description: Mus musculus mmu-miR-31-5p mature miRNA
• Sequence: 28 - AGGCAAGAUGCUGGCAUAGCUG - 49
• Evidence: experimental ; cloned [1-2], Illumina [3-4]

Mature mmu-miR-31-3p

• Accession: MIMAT0004634
• Description: Mus musculus mmu-miR-31-3p mature miRNA
• Sequence: 64 - UGCUAUGCCAACAUAUUGCCAUC - 86
• Evidence: experimental ; cloned [2], Illumina [3-4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12919684
   Embryonic stem cell-specific MicroRNAs
   "Houbaviy HB, Murray MF, Sharp PA"
   "Dev Cell (2003) 5:351-358


3. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


4. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009