| Accession | MIMAT0000538 |
| Description | mmu-miR-31-5p mature miRNA |
| Hairpins | |
| Sequence | AGGCAAGAUGCUGGCAUAGCUG |
| Evidence |
experimental
cloned [1-2], Illumina [3-4] |
| Database links |
|
| Predicted targets |
|
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.