miRBase entry: rno-mir-322-1

Stem-loop rno-mir-322-1


Accession
MI0000589
Description
Rattus norvegicus rno-mir-322-1 precursor miRNA

Literature search
14 open access papers mention rno-mir-322-1
(93 sentences)

Sequence

707842 reads, 680.0 reads per million, 509 experiments
ccucgcugacuccgaagggaugCAGCAGCAAUUCAUGUUUUGGAguauugccaagguucaAAACAUGAAGCGCUGCAACACcccuucgugggaaa
.........((((((((((.((..(((((..(((((((((((((.(........).)))))))))))))..)))))..)).))))))).)))...

Structure
ccucgcuga   -       a  CA     AA             g auu 
         cuc cgaaggg ug  GCAGC  UUCAUGUUUUGGA u   g
         ||| ||||||| ||  |||||  ||||||||||||| |    
         ggg gcuuccc AC  CGUCG  AAGUACAAAacuu g   c
------aaa   u       C  AA     CG             g aac 


Annotation confidence High
Do you think this miRNA is real?
Comments
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The miR-322 locus has an orthologous sequence in human (MIR:MI0001446), which expresses an experimentally validated mature miRNA sequence from its 5' arm, named miR-424. The human mir-424 locus does not appear to contain a homolog of the miR-322 sequence. The mouse ortholog (MIR:MI0000590) appears able to express both miR-322 and miR-424. Both miR-322 and miR-424 have been experimentally verified in rat. Landgraf et al. show that the 5' product is the predominant one [3]. The 5' product is therefore renamed miR-322 and the 3' product renamed miR-322*.

Genome context
chrX: 158148161-158148255 [+]
Clustered miRNAs
6 other miRNAs are < 10 kb from rno-mir-322-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-322-5p

Accession MIMAT0001619
Description Rattus norvegicus rno-miR-322-5p mature miRNA
Sequence 23 - CAGCAGCAAUUCAUGUUUUGGA - 44
Evidence experimental
cloned [2-3], SOLiD [4]

Mature rno-miR-322-3p

Accession MIMAT0000547
Description Rattus norvegicus rno-miR-322-3p mature miRNA
Sequence 61 - AAACAUGAAGCGCUGCAACAC - 81
Evidence experimental
cloned [1-2], SOLiD [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249