Stem-loop rno-mir-322-1

Accession

MI0000589

Description

Rattus norvegicus rno-mir-322-1 precursor miRNA

Literature search

14 open access papers mention rno-mir-322-1
(99 sentences)

Sequence

403166 reads, 305 reads per million, 495 experiments

ccucgcugacuccgaagggaugCAGCAGCAAUUCAUGUUUUGGAguauugccaagguucaAAACAUGAAGCGCUGCAACAccccuucgugggaaa
.........((((((((((.((..(((((..(((((((((((((.(........).)))))))))))))..)))))..)).))))))).)))...

Structure

ccucgcuga   -       a  CA     AA             g auu 
         cuc cgaaggg ug  GCAGC  UUCAUGUUUUGGA u   g
         ||| ||||||| ||  |||||  ||||||||||||| |    
         ggg gcuuccc AC  CGUCG  AAGUACAAAacuu g   c
------aaa   u       c  AA     CG             g aac 

Annotation confidence Medium

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The miR-322 locus has an orthologous sequence in human (MIR:MI0001446), which expresses an experimentally validated mature miRNA sequence from its 5' arm, named miR-424. The human mir-424 locus does not appear to contain a homolog of the miR-322 sequence. The mouse ortholog (MIR:MI0000590) appears able to express both miR-322 and miR-424. Both miR-322 and miR-424 have been experimentally verified in rat. Landgraf et al. show that the 5' product is the predominant one [3]. The 5' product is therefore renamed miR-322 and the 3' product renamed miR-322*.

Genome context

chrX: 158148161-158148255 [+]

Clustered miRNAs

5 other miRNAs are < 10 kb from rno-mir-322-1

Mature rno-miR-322-5p

• Accession: MIMAT0001619
• Description: Rattus norvegicus rno-miR-322-5p mature miRNA
• Sequence: 23 - CAGCAGCAAUUCAUGUUUUGGA - 44
• Evidence: experimental ; cloned [2-3], SOLiD [4]

Mature rno-miR-322-3p

• Accession: MIMAT0000547
• Description: Rattus norvegicus rno-miR-322-3p mature miRNA
• Sequence: 61 - AAACAUGAAGCGCUGCAACA - 80
• Evidence: experimental ; cloned [1-2], SOLiD [4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


3. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365


4. PubMed ID: 20403161
   Small RNA expression and strain specificity in the rat
   Linsen SE, de Wit E, de Bruijn E, Cuppen E
   BMC Genomics (2010) 11:249