miRBase entry: mmu-mir-322

Stem-loop mmu-mir-322


Accession
MI0000590
Symbol
MGI: Mir322
Description
Mus musculus mmu-mir-322 precursor miRNA mir-322
Gene
family?
RF00737; mir-322

Literature search
43 open access papers mention mmu-mir-322
(390 sentences)

Sequence

489744 reads, 4232 reads per million, 106 experiments
ccucguugacuccgaagggcugCAGCAGCAAUUCAUGUUUUGGAguauugccaagguucaAAACAUGAAGCGCUGCAACACcccuucguggggaa
.........((((((((((.((..(((((..(((((((((((((.(........).)))))))))))))..)))))..)).))))))).)))...

Structure
ccucguuga   -       c  CA     AA             g auu 
         cuc cgaaggg ug  GCAGC  UUCAUGUUUUGGA u   g
         ||| ||||||| ||  |||||  ||||||||||||| |    
         ggg gcuuccc AC  CGUCG  AAGUACAAAacuu g   c
------aag   u       C  AA     CG             g aac 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mir-322 locus appears able to express two mature miRNA sequences. Poy et al. cloned a sequence originating from the 5' arm from mouse pancreatic beta cells [2]. This sequence is orthologous to the experimentally validated miR-424 sequence from human (MIR:MI0001446), but was named miR-322-5p in [2]. The mature product from the 3' arm of this precursor sequence is the predicted mouse homologue of miR-322, experimentally verified in rat (MIR:MI0000589) [1], and later in mouse [3]. The orthologous human locus does not appear to contain the miR-322 sequence. Landgraf et al. confirm that the 5' product is the predominant one [4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chrX: 53054255-53054349 [-]
Clustered miRNAs
6 other miRNAs are < 10 kb from mmu-mir-322
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-322-5p

Accession MIMAT0000548
Description Mus musculus mmu-miR-322-5p mature miRNA
Sequence 23 - CAGCAGCAAUUCAUGUUUUGGA - 44
Evidence experimental
cloned [2,4], Illumina [5-6]
Database links
Predicted targets

Mature mmu-miR-322-3p

Accession MIMAT0000549
Description Mus musculus mmu-miR-322-3p mature miRNA
Sequence 61 - AAACAUGAAGCGCUGCAACAC - 81
Evidence experimental
cloned [3-4], Illumina [5-6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  3. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  6. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365