miRBase entry: rno-mir-301a

Stem-loop rno-mir-301a


Accession
MI0000593
Description
Rattus norvegicus rno-mir-301a precursor miRNA

Literature search
12 open access papers mention rno-mir-301a
(240 sentences)

Sequence

254049 reads, 366 reads per million, 500 experiments
ccugcuggcuacugcugacgacuGCUCUGACUUUAUUGCACUACuguacuguacagcuagCAGUGCAAUAGUAUUGUCAAAGCauccgggagcaggcuac
.....((((..(((((..((..((((.((((.((((((((((.((((........)).)).))))))))))....)))).))))..))..))))))))).

Structure
ccugc    ua     ga  ac    C    ---U          A  -  acu 
     uggc  cugcu  cg  uGCU UGAC    UUAUUGCACU Cu gu   g
     ||||  |||||  ||  |||| ||||    |||||||||| || ||    
     aucg  gacga  gc  aCGA ACUG    GAUAACGUGA ga cg   u
----c    --     gg  cu    A    UUAU          C  u  aca 


Annotation confidence High
Do you think this miRNA is real?
Comments
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This rat miRNA has an independently verified homologue in mouse (MIR:MI0000401). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chr10: 74417746-74417845 [+]

Database links

Mature rno-miR-301a-5p

Accession MIMAT0017026
Description Rattus norvegicus rno-miR-301a-5p mature miRNA
Sequence 24 - GCUCUGACUUUAUUGCACUAC - 44
Evidence experimental
SOLiD [4]

Mature rno-miR-301a-3p

Accession MIMAT0000552
Description Rattus norvegicus rno-miR-301a-3p mature miRNA
Sequence 61 - CAGUGCAAUAGUAUUGUCAAAGC - 83
Evidence experimental
cloned [1-3], SOLiD [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249