miRBase entry: rno-let-7d

Stem-loop rno-let-7d


Accession
MI0000601
Description
Rattus norvegicus rno-let-7d precursor miRNA

Literature search
261 open access papers mention rno-let-7d
(992 sentences)

Sequence

1412086 reads, 1605.0 reads per million, 514 experiments
ugggcuccuaggaAGAGGUAGUAGGUUGCAUAGUUUuagggcagagauuuugcccacaaggaguuaaCUAUACGACCUGCUGCCUUUCUUagggccuu
.((((.(((((((.((((((((((((((.((((((...(((((((...)))))))..........)))))).))))))))))))))))))))))))).

Structure
u    u       A              C      -------Uua       g 
 gggc ccuagga GAGGUAGUAGGUUG AUAGUU          gggcaga  
 |||| ||||||| |||||||||||||| ||||||          ||||||| a
 uccg ggaUUCU UUCCGUCGUCCAGC UAUCaa          cccguuu  
u    -       -              A      uugaggaaca       u 


Annotation confidence High
Do you think this miRNA is real?
Comments
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons, including the sequence identical to the miRNA cloned from the reverse strand of mouse let-7d (MIR:MI0000405), named let-7* [1]. The predicted precursor sequence from a newer assembly of the rat genome also contains the let-7d sequence in the 5' arm. The let-7d* sequence published in [1] had an extra 3' A residue, which conflicts with the sequence of the precursor shown here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chr17: 16419980-16420077 [+]
Clustered miRNAs
4 other miRNAs are < 10 kb from rno-let-7d
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-let-7d-5p

Accession MIMAT0000562
Description Rattus norvegicus rno-let-7d-5p mature miRNA
Sequence 14 - AGAGGUAGUAGGUUGCAUAGUUU - 36
Evidence experimental
cloned [1-4], SOLiD [5]

Mature rno-let-7d-3p

Accession MIMAT0000563
Description Rattus norvegicus rno-let-7d-3p mature miRNA
Sequence 68 - CUAUACGACCUGCUGCCUUUCUU - 90
Evidence experimental
cloned [1,4], Northern [1], SOLiD [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  5. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68