Stem-loop rno-let-7d

Accession

MI0000601

Description

Rattus norvegicus rno-let-7d precursor miRNA

Gene family

MIPF0000002; let-7

Literature search

105 open access papers mention rno-let-7d
(552 sentences)

Sequence

1149743 reads, 1221 reads per million, 507 experiments

ugggcuccuaggaAGAGGUAGUAGGUUGCAUAGUUuuagggcagagauuuugcccacaaggaguuaaCUAUACGACCUGCUGCCUUUCUuagggccuu
.((((.(((((((.((((((((((((((.((((((...(((((((...)))))))..........)))))).))))))))))))))))))))))))).

Structure

u    u       A              C      -------uua       g 
 gggc ccuagga GAGGUAGUAGGUUG AUAGUU          gggcaga  
 |||| ||||||| |||||||||||||| ||||||          ||||||| a
 uccg ggauUCU UUCCGUCGUCCAGC UAUCaa          cccguuu  
u    -       -              A      uugaggaaca       u 

Annotation confidence High

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons, including the sequence identical to the miRNA cloned from the reverse strand of mouse let-7d (MIR:MI0000405), named let-7* [1]. The predicted precursor sequence from a newer assembly of the rat genome also contains the let-7d sequence in the 5' arm. The let-7d* sequence published in [1] had an extra 3' A residue, which conflicts with the sequence of the precursor shown here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

chr17: 16419980-16420077 [+]

Clustered miRNAs

4 other miRNAs are < 10 kb from rno-let-7d

Mature rno-let-7d-5p

• Accession: MIMAT0000562
• Description: Rattus norvegicus rno-let-7d-5p mature miRNA
• Sequence: 14 - AGAGGUAGUAGGUUGCAUAGUU - 35
• Evidence: experimental ; cloned [1-4], SOLiD [5]

Mature rno-let-7d-3p

• Accession: MIMAT0000563
• Description: Rattus norvegicus rno-let-7d-3p mature miRNA
• Sequence: 68 - CUAUACGACCUGCUGCCUUUCU - 89
• Evidence: experimental ; cloned [1,4], Northern [1], SOLiD [5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


3. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365


4. PubMed ID: 20403161
   Small RNA expression and strain specificity in the rat
   Linsen SE, de Wit E, de Bruijn E, Cuppen E
   BMC Genomics (2010) 11:249


5. PubMed ID: 15345052
   Microarray analysis of microRNA expression in the developing mammalian brain
   Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
   Genome Biol (2004) 5:R68