miRBase entry: rno-mir-140

Stem-loop rno-mir-140


Accession
MI0000611
Description
Rattus norvegicus rno-mir-140 precursor miRNA

Literature search
35 open access papers mention rno-mir-140
(175 sentences)

Sequence

612529 reads, 709 reads per million, 501 experiments
gugucucucucuguguccugcCAGUGGUUUUACCCUAUGGUAGguuacaucaugcuguucUACCACAGGGUAGAACCACGGacaggauacuggagcacc
(((.((((....((((((((((.(((((((((((((.(((((((..(((......)))))))))).))))))))))))))).)))))))).))))))).

Structure
-   u    cucu        -  A             A       uu   uc 
 gug cucu    guguccug cC GUGGUUUUACCCU UGGUAGg  aca  a
 ||| ||||    |||||||| || ||||||||||||| |||||||  |||   
 cac gagg    cauaggac GG CACCAAGAUGGGA ACCAUcu  ugu  u
c   -    ---u        a  -             C       --   cg 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The cloned miRNA appears to be expressed from the 3' strand of the precursor, and is therefore named miR-140* here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chr19: 39608951-39609049 [+]

Database links

Mature rno-miR-140-5p

Accession MIMAT0000573
Description Rattus norvegicus rno-miR-140-5p mature miRNA
Sequence 22 - CAGUGGUUUUACCCUAUGGUAG - 43
Evidence experimental
cloned [3-4], SOLiD [5]

Mature rno-miR-140-3p

Accession MIMAT0000574
Description Rattus norvegicus rno-miR-140-3p mature miRNA
Sequence 61 - UACCACAGGGUAGAACCACGG - 81
Evidence experimental
cloned [1-2,4], Northern [1], SOLiD [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  5. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68