miRBase entry: rno-mir-345

Stem-loop rno-mir-345


Accession
MI0000631
Description
Rattus norvegicus rno-mir-345 precursor miRNA

Literature search
6 open access papers mention rno-mir-345
(24 sentences)

Sequence

26766 reads, 1116 reads per million, 488 experiments
acccaaguccaggccUGCUGACCCCUAGUCCAGUGCuugugguggcuacugggCCCUGAACUAGGGGUCUGGAGAccuggguuugaucuccacagg
...((((((((((.((.(.((((((((((.(((.((((((((...)))).)))).))).)))))))))).).)).))))))))))...........

Structure
--------acc          c  G U          C   U    -    u 
           caaguccagg cU C GACCCCUAGU CAG GCuu gugg  
           |||||||||| || | |||||||||| ||| |||| |||| g
           guuugggucc GA G CUGGGGAUCA GUC Cggg cauc  
ggacaccucua          A  G U          A   C    u    g 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr6: 132748968-132749063 [+]

Database links

Mature rno-miR-345-5p

Accession MIMAT0000594
Description Rattus norvegicus rno-miR-345-5p mature miRNA
Sequence 16 - UGCUGACCCCUAGUCCAGUGC - 36
Evidence experimental
cloned [1-3], Northern [1], SOLiD [5]

Mature rno-miR-345-3p

Accession MIMAT0004655
Description Rattus norvegicus rno-miR-345-3p mature miRNA
Sequence 54 - CCCUGAACUAGGGGUCUGGAGA - 75
Evidence experimental
cloned [4], SOLiD [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  5. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68