miRBase entry: rno-mir-20a

Stem-loop rno-mir-20a


Accession
MI0000638
Description
Rattus norvegicus rno-mir-20a precursor miRNA
Gene family
MIPF0000001; mir-17

Literature search
49 open access papers mention rno-mir-20a
(170 sentences)

Sequence

55828 reads, 85 reads per million, 489 experiments
cagcuucuguagcacUAAAGUGCUUAUAGUGCAGGUAGugugucgucaucuACUGCAUUACGAGCACUUACAguacugccagcug
(((((...((((.(((.((((((((.((((((((.(((.(((....)))))))))))))).))))))))..))).)))).)))))

Structure
     ucu    c   -A        A        G   u   u 
cagcu   guag acU  AAGUGCUU UAGUGCAG UAG gug c
|||||   |||| |||  |||||||| |||||||| ||| |||  
gucga   cguc ugA  UUCACGAG AUUACGUC Auc uac g
     --c    a   CA        C        -   -   u 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr15: 100180334-100180418 [+]
Clustered miRNAs
5 other miRNAs are < 10 kb from rno-mir-20a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-20a-5p

Accession MIMAT0000602
Description Rattus norvegicus rno-miR-20a-5p mature miRNA
Sequence 16 - UAAAGUGCUUAUAGUGCAGGUAG - 38
Evidence experimental
cloned [1-3], SOLiD [4]

Mature rno-miR-20a-3p

Accession MIMAT0000603
Description Rattus norvegicus rno-miR-20a-3p mature miRNA
Sequence 52 - ACUGCAUUACGAGCACUUACA - 72
Evidence experimental
cloned [1], SOLiD [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249