miRBase entry: mmu-mir-350

Stem-loop mmu-mir-350


Accession
MI0000640
Symbol
MGI: Mir350
Description
Mus musculus mmu-mir-350 precursor miRNA mir-350
Gene
family?
RF00806; mir-350

Literature search
9 open access papers mention mmu-mir-350
(37 sentences)

Sequence

33166 reads, 352 reads per million, 105 experiments
agaugccuugcuccuacaagaguAAAGUGCAUGCGCUUUGGGacagugaggaaaauaaugUUCACAAAGCCCAUACACUUUCacccuuuaggagaguug
..........((((((.(((.((((((((.(((.(((((((((((.............))))).)))))).))).)))))).)).))))))))).....

Structure
agaugccuug      c   a  -      C   C      -     gugag 
          cuccua aag gu AAAGUG AUG GCUUUG GGaca     g
          |||||| ||| || |||||| ||| |||||| |||||     a
          gaggau uuc ca UUUCAC UAC CGAAAC CUUgu     a
-----guuga      -   c  C      A   C      A     aauaa 


Annotation confidence High
Do you think this miRNA is real?
Comments
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000639) - its expression was later independently verified in mouse [2]. The sequence reported in [1] contains a 5' terminal A residue, which conflicts with the precursor sequence shown here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr1: 176772325-176772423 [-]

Database links

Mature mmu-miR-350-5p

Accession MIMAT0017040
Description Mus musculus mmu-miR-350-5p mature miRNA
Sequence 24 - AAAGUGCAUGCGCUUUGGG - 42
Evidence experimental
454 [5], Illumina [6]
Database links
Predicted targets

Mature mmu-miR-350-3p

Accession MIMAT0000605
Description Mus musculus mmu-miR-350-3p mature miRNA
Sequence 61 - UUCACAAAGCCCAUACACUUUC - 82
Evidence experimental
cloned [2-3], Illumina [4,6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  5. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275

  6. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365