Stem-loop rno-mir-351-1

Accession

MI0000642

Description

Rattus norvegicus rno-mir-351-1 precursor miRNA

Literature search

12 open access papers mention rno-mir-351-1
(26 sentences)

Sequence

1415024 reads, 1005 reads per million, 498 experiments

cauggcaccuccauuUCCCUGAGGAGCCCUUUGAGCCUGAggugaaaaaaaaacaGGUCAAGAGGCGCCUGGGAACuggag
........(((((.(((((..(((.(((.(((((.((((..............))))))))).))).)))))))).)))))

Structure

cauggcac     u     UG   A   C     G    Agguga 
        cucca uUCCC  AGG GCC UUUGA CCUG      a
        ||||| |||||  ||| ||| ||||| ||||       
        gaggu AAGGG  UCC CGG GAACU GGac      a
--------     C     --   G   A     -    aaaaaa 

Annotation confidence Medium

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The sequence reported in [1] contains a 3' terminal U residue, which conflicts with the precursor sequence shown here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

chrX: 158149206-158149286 [+]

Clustered miRNAs

6 other miRNAs are < 10 kb from rno-mir-351-1

Mature rno-miR-351-5p

• Accession: MIMAT0000608
• Description: Rattus norvegicus rno-miR-351-5p mature miRNA
• Sequence: 16 - UCCCUGAGGAGCCCUUUGAGCCUGA - 40
• Evidence: experimental ; cloned [1-3], Northern [1], SOLiD [4]

Mature rno-miR-351-3p

• Accession: MIMAT0017041
• Description: Rattus norvegicus rno-miR-351-3p mature miRNA
• Sequence: 56 - GGUCAAGAGGCGCCUGGGAAC - 76
• Evidence: experimental ; SOLiD [4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


3. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365


4. PubMed ID: 20403161
   Small RNA expression and strain specificity in the rat
   Linsen SE, de Wit E, de Bruijn E, Cuppen E
   BMC Genomics (2010) 11:249