miRBase entry: rno-mir-151

Stem-loop rno-mir-151


Accession
MI0000647
Description
Rattus norvegicus rno-mir-151 precursor miRNA

Literature search
53 open access papers mention rno-mir-151
(163 sentences)

Sequence

2578779 reads, 3069.0 reads per million, 517 experiments
agcgcuuuccugcccUCGAGGAGCUCACAGUCUAGUAUGucuccucccuaCUAGACUGAGGCUCCUUGAGGAcagggaucgucauacucaccucccg
.(((..((((((.((((((((((((..((((((((((.(........))))))))))).)))))))))))).)))))).)))...............

Structure
--------------a   cu      c            CA          U ucu 
               gcg  uuccug ccUCGAGGAGCU  CAGUCUAGUA G   c
               |||  |||||| ||||||||||||  |||||||||| |    
               ugc  agggac GGAGUUCCUCGG  GUCAGAUCau c   c
gcccuccacucauac   -u      A            -A          - ccu 


Annotation confidence High
Do you think this miRNA is real?
Comments
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. Landgraf et al show that the 5' product is the predominant one [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chr7: 114485547-114485643 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from rno-mir-151
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-151-5p

Accession MIMAT0000613
Description Rattus norvegicus rno-miR-151-5p mature miRNA
Sequence 16 - UCGAGGAGCUCACAGUCUAGUAUG - 39
Evidence experimental
cloned [1-3], SOLiD [4]

Mature rno-miR-151-3p

Accession MIMAT0000614
Description Rattus norvegicus rno-miR-151-3p mature miRNA
Sequence 51 - CUAGACUGAGGCUCCUUGAGGA - 72
Evidence experimental
cloned [3], SOLiD [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249