Stem-loop mmu-mir-101b

Accession

MI0000649

Symbol

MGI: Mir101b

Description

Mus musculus mmu-mir-101b precursor miRNA mir-101

Gene
family

RF00253; mir-101

Literature search

114 open access papers mention mmu-mir-101b
(837 sentences)

Sequence

956378 reads, 2519 reads per million, 107 experiments

aucugagacugaacugcccuuuuUCGGUUAUCAUGGUACCGAUGCUguagcucugaaagGUACAGUACUGUGAUAGCUgaagaauggcggugccauc
............((((((.((((((((((((((((((......((((((.((.....)).)))))))))))))))))))))))).))))))......

Structure

aucugagacuga      c                  ACCGAU      g  c 
            acugcc uuuuUCGGUUAUCAUGGU      GCUgua cu u
            |||||| ||||||||||||||||||      |||||| || g
            uggcgg aagaagUCGAUAGUGUCA      UGACAU ga a
------cuaccg      u                  ------      G  a 

Annotation confidence High

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000648) -- expression in mouse was verified independently [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

chr19: 29135279-29135375 [+]

Mature mmu-miR-101b-5p

• Accession: MIMAT0017046
• Description: Mus musculus mmu-miR-101b-5p mature miRNA
• Sequence: 24 - UCGGUUAUCAUGGUACCGAUGCU - 46
• Evidence: experimental ; Illumina [5]

Mature mmu-miR-101b-3p

• Accession: MIMAT0000616
• Description: Mus musculus mmu-miR-101b-3p mature miRNA
• Sequence: 60 - GUACAGUACUGUGAUAGCU - 78
• Evidence: experimental ; cloned [2-3], Illumina [4-5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15538371
   A pancreatic islet-specific microRNA regulates insulin secretion
   "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
   "Nature (2004) 432:226-230


3. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


4. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


5. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365