MIR1-1 is a muscle-specific microRNA primarily associated with skeletal muscle development in mammals [PMC5424345]. It is one of the canonical cardiac myomiRs, which include MIR1-1, MIR126, MIR133, and MIR208, and its expression is crucial during the early stages of cardiogenesis [PMC6828809][PMC7123062[PMC7123062]. This microRNA is also involved in the regulation of cardiac contraction and embryonic angiogenesis [PMC8624534]. It forms part of a bicistronic cluster with miR133a, which collectively regulates multiple mRNAs involved in muscle differentiation and myogenesis [PMC9185982][PMC5137429[PMC5137429]. Moreover, MIR1-1 has been implicated in MET-dependent proliferation in colorectal cancer (CRC) and has been observed to have a copy number gain in a subset of patients with this disease [PMC4967895]. In the context of prostate cancer (PCa), differentially expressed genes (DEGs) have been identified following miR-1 pretreatment by searching databases such as GEO and ArrayExpress [PMC6236292]. Additionally, research has identified that sequence variations in MIR1-1 are not associated with long QT syndrome (LQTS) within certain cohorts studied [PMC4196592], indicating its specificity to muscle-related functions.
a GC --- a uggga ACAUACUUCUUUAUAU CCAUa ugg c ||||| |||||||||||||||| ||||| ||| c acucU UGUAUGAAGAAAUGUA GGUau auc u A -A cga g
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000416 |
Description | Homo sapiens hsa-miR-1-3p mature miRNA |
Sequence | 46 - UGGAAUGUAAAGAAGUAUGUAU - 67 |
Evidence |
experimental
cloned [2], Illumina [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0031892 |
Description | Homo sapiens hsa-miR-1-5p mature miRNA |
Sequence | 7 - ACAUACUUCUUUAUAUGCCCAU - 28 |
Evidence | not_experimental |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|