miRBase entry: osa-MIR156h

Stem-loop osa-MIR156h


Accession
MI0000660
Description
Oryza sativa osa-MIR156h precursor miRNA

Literature search
120 open access papers mention osa-MIR156h
(655 sentences)

Sequence

542534 reads, 374932 reads per million, 2 experiments
aguUGACAGAAGAGAGUGAGCACacagcggccagacugcaucgaucuaucaaucuucccuucgacaggauagcuagauagaaagaaagagaggccgucggcggccauggaagagagagagagagagagaugaaaugaugaugaugauacagcugccgcugcguGCUCACUUCUCUUUCUGUCAGCu
(((((((((((((((((((((((.(((((((.((.(((((((..(((.((..((((..((((...((.....)).................(((((....)))))...)))).))))..)).)))..))))..((.((....)).)).)))))))))))).)))))))).)))).)))))))))))

Structure
           -    -        a       c  a   -----------------    ga   a  aa    cc    gacaggauagcuagauagaaagaaagaga     u 
aguUGACAGAA GAGA GUGAGCAC cagcggc ag cug                 cauc  ucu uc  ucuu  cuuc                             ggccg c
||||||||||| |||| |||||||| ||||||| || |||                 ||||  ||| ||  ||||  ||||                             |||||  
uCGACUGUCUU CUCU CACUCGug gucgccg uc gac                 guag  aga ag  agag  gaag                             ccggc g
           U    U        c       -  -   auaguaguaguaguaaa    ag   g  ag    -a    --------------------------gua     g 


Annotation confidence High
Do you think this miRNA is real?

Genome context
Chr8: 21491232-21491417 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from osa-MIR156h
Name Accession Chromosome Start End Strand Confidence




Database links

Mature osa-miR156h-5p

Accession MIMAT0031156
Description Oryza sativa osa-miR156h-5p mature miRNA
Sequence 4 - UGACAGAAGAGAGUGAGCAC - 23
Evidence not_experimental
Database links

Mature osa-miR156h-3p

Accession MIMAT0031157
Description Oryza sativa osa-miR156h-3p mature miRNA
Sequence 164 - GCUCACUUCUCUUUCUGUCAGC - 185
Evidence experimental
Illumina [2]
Database links

References

  1. PubMed ID: 12101121
    MicroRNAs in plants
    "Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP"
    "Genes Dev (2002) 16:1616-1626

  2. PubMed ID: 21901091
    Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors
    Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y
    PLoS Pathog (2011) 7:e1002176