MIR155 is a noncoding microRNA transcript of the B-cell integration cluster gene, implicated in the regulation of various cellular processes, including immune response and oncogenesis [PMC7912829]. It has been observed to play a role in osteogenic differentiation, with its inhibition leading to upregulated osteogenesis of mesenchymal stem cells [PMC9288680]. Studies using MIR155 knockout mice suggest its involvement in macrophage accumulation and metabolic profile regulation in obesity settings [PMC5617927]. MIR155 is also associated with autophagic activity, with its overexpression increasing and knockdown alleviating autophagy under hypoxic conditions [PMC4389881]. Its role extends to vascular smooth muscle cell proliferation and has been proposed as a potential target for future research on vascular calcification using cell type-specific knockout models [PMC7123062], [PMC7810936]. Additionally, MIR155 is recognized as an oncomiR due to its involvement in various cancers including breast cancer, leukemia, lymphoma, lung cancer, and liver cancer [PMC5361868]. Its expression profile has been associated with the diagnosis and progression of breast cancer when examined alongside other microRNAs [PMC3046429]. Furthermore, MIR155's regulatory effects on immune cells have been highlighted for their potential implications in autoimmune diseases such as rheumatoid arthritis [PMC8534545], [PMC5351619].
C A -u c cugUUAAUGCUAAU GUG UAGGGGUU uug c |||||||||||||| ||| |||||||| ||| gACAAUUACGAUUA UAC AUCCUCag aac u - - uc c
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000646 |
Description | Homo sapiens hsa-miR-155-5p mature miRNA |
Sequence | 4 - UUAAUGCUAAUCGUGAUAGGGGUU - 27 |
Evidence |
experimental
cloned [2,5-7] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004658 |
Description | Homo sapiens hsa-miR-155-3p mature miRNA |
Sequence | 43 - CUCCUACAUAUUAGCAUUAACA - 64 |
Evidence |
experimental
cloned [5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|