miRBase entry: hsa-mir-155

Stem-loop hsa-mir-155


Accession
MI0000681
Symbol
HGNC: MIR155
Description
Homo sapiens hsa-mir-155 precursor miRNA mir-155
Gene
family?
RF00731; mir-155

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR155 is a noncoding microRNA transcript of the B-cell integration cluster gene, implicated in the regulation of various cellular processes, including immune response and oncogenesis [PMC7912829]. It has been observed to play a role in osteogenic differentiation, with its inhibition leading to upregulated osteogenesis of mesenchymal stem cells [PMC9288680]. Studies using MIR155 knockout mice suggest its involvement in macrophage accumulation and metabolic profile regulation in obesity settings [PMC5617927]. MIR155 is also associated with autophagic activity, with its overexpression increasing and knockdown alleviating autophagy under hypoxic conditions [PMC4389881]. Its role extends to vascular smooth muscle cell proliferation and has been proposed as a potential target for future research on vascular calcification using cell type-specific knockout models [PMC7123062], [PMC7810936]. Additionally, MIR155 is recognized as an oncomiR due to its involvement in various cancers including breast cancer, leukemia, lymphoma, lung cancer, and liver cancer [PMC5361868]. Its expression profile has been associated with the diagnosis and progression of breast cancer when examined alongside other microRNAs [PMC3046429]. Furthermore, MIR155's regulatory effects on immune cells have been highlighted for their potential implications in autoimmune diseases such as rheumatoid arthritis [PMC8534545], [PMC5351619].

Literature search
1009 open access papers mention hsa-mir-155
(8276 sentences)

Sequence

84128 reads, 459 reads per million, 127 experiments
cugUUAAUGCUAAUCGUGAUAGGGGUUuuugccuccaacugaCUCCUACAUAUUAGCAUUAACAg
((((((((((((((.(((.((((((((.(((....)))..)))))))))))))))))))))))))

Structure
              C   A        -u   c 
cugUUAAUGCUAAU GUG UAGGGGUU  uug c
|||||||||||||| ||| ||||||||  |||  
gACAAUUACGAUUA UAC AUCCUCag  aac u
              -   -        uc   c 


Annotation confidence High
Do you think this miRNA is real?
Comments
Human mir-155 is predicted based on homology to a cloned miR from mouse (MIR:MI0000177) [1], and later experimentally validated in human HL-60 leukemia cells [2]. Like the mouse miRNA, human mir-155 resides in the non-coding BIC transcript (EMBL:AF402776), located on chromosome 21 [3]. The mature form differs from that in mouse at a single position. Eis et al. confirm that miR-155 is processed from the BIC transcript in human, and demonstrate elevated expression of miR-155 in lymphoma samples [4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context
chr21: 25573980-25574044 [+]

Disease association
hsa-mir-155 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-155 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-155 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-155-5p

Accession MIMAT0000646
Description Homo sapiens hsa-miR-155-5p mature miRNA
Sequence 4 - UUAAUGCUAAUCGUGAUAGGGGUU - 27
Evidence experimental
cloned [2,5-7]
Database links
Predicted targets

Mature hsa-miR-155-3p

Accession MIMAT0004658
Description Homo sapiens hsa-miR-155-3p mature miRNA
Sequence 43 - CUCCUACAUAUUAGCAUUAACA - 64
Evidence experimental
cloned [5]
Database links
Predicted targets

References

  1. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 17989717
    Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis
    "Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A"
    "Leukemia (2008) 22:330-338

  5. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  7. PubMed ID: 15738415
    Accumulation of miR-155 and BIC RNA in human B cell lymphomas
    "Eis PS, Tam W, Sun L, Chadburn A, Li Z, Gomez MF, Lund E, Dahlberg JE"
    "Proc Natl Acad Sci U S A (2005) 102:3627-3632