miRBase entry: mmu-mir-17

Stem-loop mmu-mir-17


Accession
MI0000687
Symbol
MGI: Mir17
Description
Mus musculus mmu-mir-17 precursor miRNA mir-17
Gene
family?
RF00051; mir-17

Literature search
321 open access papers mention mmu-mir-17
(3241 sentences)

Sequence

283920 reads, 2249 reads per million, 107 experiments
gucagaauaauguCAAAGUGCUUACAGUGCAGGUAGugaugugugcaucuACUGCAGUGAGGGCACUUGUAGcauuaugcugac
(((((.(((((((..((((((((.((.(((((.....((((....))))..))))).)).))))))))...))))))).)))))

Structure
     a       -CA        A  G     GUAGu    u 
gucag auaaugu   AAGUGCUU CA UGCAG     gaug g
||||| |||||||   |||||||| || |||||     ||||  
caguc uauuacG   UUCACGGG GU ACGUC     cuac u
     g       AUG        A  G     ---Au    g 


Annotation confidence High
Do you think this miRNA is real?
Comments
Mouse mir-17 is predicted [4] based on homology to a cloned miR from human (MIR:MI0000071) [1,2]. miRNAs derived from the 5' [1] and 3' [2] arms of the human mir-17 precursor have been reported. Landgraf et al. show that the 5' product is the predominant one [5]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context
chr14: 115043671-115043754 [+]
Clustered miRNAs
5 other miRNAs are < 10 kb from mmu-mir-17
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-17-5p

Accession MIMAT0000649
Description Mus musculus mmu-miR-17-5p mature miRNA
Sequence 14 - CAAAGUGCUUACAGUGCAGGUAG - 36
Evidence experimental
cloned [5], Illumina [6-7]
Database links
Predicted targets

Mature mmu-miR-17-3p

Accession MIMAT0000650
Description Mus musculus mmu-miR-17-3p mature miRNA
Sequence 51 - ACUGCAGUGAGGGCACUUGUAG - 72
Evidence experimental
cloned [3,5], Illumina [6-7]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728

  4. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  5. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  6. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  7. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73