miRBase entry: mmu-mir-25

Stem-loop mmu-mir-25


Accession
MI0000689
Symbol
MGI: Mir25
Description
Mus musculus mmu-mir-25 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Mmu-mir-25 is a microRNA that is part of the miR-106b~25 cluster, which also includes mmu-miR-106b and mmu-miR-93, and is located within the 13th intron of the MCM7 gene [PMC7803573]. It has been identified as one of the miRNAs with a regulatory role in mice, with its expression being upregulated in diet-induced obesity (DIO) mice that were subsequently fed a low-fat diet (LFD) [PMC4571067]. Additionally, mmu-mir-25 has been found to be prominent in regulatory networks due to its high degree of connectivity [PMC3692539]. Its expression is also notably high during superovulation processes in mice [PMC4499447]. Research has shown that overexpression of mmu-mir-25 can significantly enhance induced pluripotent stem cell (iPSC) generation, while its knockdown decreases reprogramming efficiency [PMC8946776]. Furthermore, inhibition of mmu-mir-25 can lead to increased levels of reactive oxygen species and overexpression of Nox4 [PMC8914318]'>PMC8914318], while a decrease in its expression has been observed in mice with diabetic peripheral neuropathy [PMC8914318]. These findings suggest that mmu-mir-25 plays a multifaceted role in physiological processes and disease states.

Literature search
91 open access papers mention mmu-mir-25
(506 sentences)

Sequence

3342880 reads, 8063 reads per million, 107 experiments
ggccaguguugagAGGCGGAGACUUGGGCAAUUGCuggacgcugcccugggCAUUGCACUUGUCUCGGUCUGAcagugccggcc
((((.((((((..((((.(((((..(.(((((..((((........))))..))))).)..))))).))))..)))))).))))

Structure
    a      ag    G     UU G     UG    acg 
ggcc guguug  AGGC GAGAC  G GCAAU  Cugg   c
|||| ||||||  |||| |||||  | |||||  ||||    
ccgg cgugac  UCUG CUCUG  C CGUUA  gguc   u
    c      AG    G     UU A     Cg    ccg 


Annotation confidence High
Do you think this miRNA is real?
Comments
Mouse mir-25 is predicted [3] based on homology to a cloned miR from human (MIR:MI0000082) [1]. Its expression has been later independently verified in mouse [2,4].

Genome context
chr5: 138165321-138165404 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from mmu-mir-25
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-25-5p

Accession MIMAT0017049
Description Mus musculus mmu-miR-25-5p mature miRNA
Sequence 14 - AGGCGGAGACUUGGGCAAUUGC - 35
Evidence experimental
454 [6], Illumina [7]
Database links
Predicted targets

Mature mmu-miR-25-3p

Accession MIMAT0000652
Description Mus musculus mmu-miR-25-3p mature miRNA
Sequence 52 - CAUUGCACUUGUCUCGGUCUGA - 73
Evidence experimental
cloned [2,4], Illumina [5,7]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  7. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275