Accession
MI0000689
Symbol
MGI:
Mir25
Description
Mus musculus
mmu-mir-25 precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
Mmu-mir-25 is a microRNA that is downregulated in DIO mice [PMC4571067]. It is also found to be more prominent and may play crucial roles in the regulatory network [PMC3692539]. Mmu-mir-25 has been extensively expressed during superovulation [PMC4499447]. It is a member of the miR-106b~25 cluster and is located in the 13th intron of the MCM7 gene [PMC7803573]. Overexpression of mmu-mir-25 has been shown to enhance iPSC generation, while knockdown of mmu-mir-25 decreases reprogramming efficiency [PMC8946776]. The precursor sequence of mmu-mir-25, along with upstream and downstream flanking regions, has been amplified from mouse genomic DNA [PMC8355162]. Inhibition of mmu-mir-25 increases reactive oxygen species levels and overexpression of Nox4 [PMC8914318]. Mmu-mir-25 has also been found to be decreased in mice with diabetic peripheral neuropathy [PMC8914318]. Trizol purified RNA was used to clean up miRNA samples, including mmu-mir-25, for expression profiling experiments using Illumina BeadChips [PMC3422281]. In summary, mmu-mir-25 is a downregulated microRNA in DIO mice that may play crucial roles in regulatory networks. It is expressed during superovulation and its overexpression enhances iPSC generation. Inhibition of mmu-mir-25 increases reactive oxygen species levels. Additionally, it has been found to be decreased in mice with diabetic peripheral neuropathy. The precursor sequence of mmu-miR-106b~25 cluster member mmu-miR-25 has been amplified from mouse genomic DNA for further analysis. Trizol purified RNA was used for expression profiling experiments involving mmu-mir-25. [PMC4571067] [PMC3692539] [PMC4499447] [PMC7803573] [PMC8946776] [PMC8355162] [PMC8914318] [PMC3422281].
Literature search
91 open access papers mention mmu-mir-25
(506 sentences)
(506 sentences)
Sequence
3342880
reads,
8777
reads per million, 107 experiments
ggccaguguugagAGGCGGAGACUUGGGCAAUUGCuggacgcugcccugggCAUUGCACUUGUCUCGGUCUGAcagugccggcc
((((.((((((..((((.(((((..(.(((((..((((........))))..))))).)..))))).))))..)))))).))))
((((.((((((..((((.(((((..(.(((((..((((........))))..))))).)..))))).))))..)))))).))))
Structure
a ag G UU G UG acg
ggcc guguug AGGC GAGAC G GCAAU Cugg c
|||| |||||| |||| ||||| | ||||| ||||
ccgg cgugac UCUG CUCUG C CGUUA gguc u
c AG G UU A Cg ccg
Annotation confidence
High
Do you think this miRNA is real?
Comments
Mouse mir-25 is predicted [3] based on homology to a cloned miR from human (MIR:MI0000082) [1]. Its expression has been later independently verified in mouse [2,4].
Genome context
chr5: 138165321-138165404 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from mmu-mir-25
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Database links
Mature mmu-miR-25-5p
| Accession | MIMAT0017049 |
| Description | Mus musculus mmu-miR-25-5p mature miRNA |
| Sequence | 14 - AGGCGGAGACUUGGGCAAUUGC - 35 |
| Evidence |
experimental
454 [6], Illumina [7] |
| Database links |
|
| Predicted targets |
|
Mature mmu-miR-25-3p
| Accession | MIMAT0000652 |
| Description | Mus musculus mmu-miR-25-3p mature miRNA |
| Sequence | 52 - CAUUGCACUUGUCUCGGUCUGA - 73 |
| Evidence |
experimental
cloned [2,4], Illumina [5,7] |
| Database links |
|
| Predicted targets |
|
References
|
