WARNING: This summary was generated by AI. Mmu-mir-25 is a microRNA that is part of the miR-106b~25 cluster, which also includes mmu-miR-106b and mmu-miR-93, and is located within the 13th intron of the MCM7 gene [PMC7803573]. It has been identified as one of the miRNAs with a regulatory role in mice, with its expression being upregulated in diet-induced obesity (DIO) mice that were subsequently fed a low-fat diet (LFD) [PMC4571067]. Additionally, mmu-mir-25 has been found to be prominent in regulatory networks due to its high degree of connectivity [PMC3692539]. Its expression is also notably high during superovulation processes in mice [PMC4499447]. Research has shown that overexpression of mmu-mir-25 can significantly enhance induced pluripotent stem cell (iPSC) generation, while its knockdown decreases reprogramming efficiency [PMC8946776]. Furthermore, inhibition of mmu-mir-25 can lead to increased levels of reactive oxygen species and overexpression of Nox4 [PMC8914318]'>PMC8914318], while a decrease in its expression has been observed in mice with diabetic peripheral neuropathy [PMC8914318]. These findings suggest that mmu-mir-25 plays a multifaceted role in physiological processes and disease states.
a ag G UU G UG acg
ggcc guguug AGGC GAGAC G GCAAU Cugg c
|||| |||||| |||| ||||| | ||||| ||||
ccgg cgugac UCUG CUCUG C CGUUA gguc u
c AG G UU A Cg ccg
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Accession | MIMAT0017049 |
| Description | Mus musculus mmu-miR-25-5p mature miRNA |
| Sequence | 14 - AGGCGGAGACUUGGGCAAUUGC - 35 |
| Evidence |
experimental
454 [6], Illumina [7] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000652 |
| Description | Mus musculus mmu-miR-25-3p mature miRNA |
| Sequence | 52 - CAUUGCACUUGUCUCGGUCUGA - 73 |
| Evidence |
experimental
cloned [2,4], Illumina [5,7] |
| Database links |
|
| Predicted targets |
|
|