Stem-loop mmu-mir-181a-1

Accession

MI0000697

Symbol

MGI: Mir181a-1

Description

Mus musculus mmu-mir-181a-1 precursor miRNA

Literature search

213 open access papers mention mmu-mir-181a-1
(1807 sentences)

Sequence

4244711 reads, 6982 reads per million, 107 experiments

gguugcuucagugAACAUUCAACGCUGUCGGUGAGUuuggaauucaaauaaaaACCAUCGACCGUUGAUUGUACCcuauagcuaacc
(((((((..((.(.(((.((((((..(((((((.((((.............))))))))))))))))).))).).))..))).))))

Structure

    -   uc  u A   U      CU       A    ggaau 
gguu gcu  ag g ACA UCAACG  GUCGGUG GUuu     u
|||| |||  || | ||| ||||||  ||||||| ||||     c
ccaa cga  uc C UGU AGUUGC  CAGCUAC CAaa     a
    u   ua  C A   U      --       -    aauaa 

Annotation confidence High

Genome context

chr1: 137966455-137966541 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from mmu-mir-181a-1

Mature mmu-miR-181a-5p

• Accession: MIMAT0000210
• Description: Mus musculus mmu-miR-181a-5p mature miRNA
• Sequence: 14 - AACAUUCAACGCUGUCGGUGAGU - 36
• Evidence: experimental ; cloned [2,4], Illumina [5-6]

Mature mmu-miR-181a-1-3p

• Accession: MIMAT0000660
• Description: Mus musculus mmu-miR-181a-1-3p mature miRNA
• Sequence: 54 - ACCAUCGACCGUUGAUUGUACC - 75
• Evidence: experimental ; cloned [2], Illumina [5-6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12624257
   Vertebrate microRNA genes
   "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
   "Science (2003) 299:1540


3. PubMed ID: 15538371
   A pancreatic islet-specific microRNA regulates insulin secretion
   "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
   "Nature (2004) 432:226-230


4. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


5. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


6. PubMed ID: 15634332
   New human and mouse microRNA genes found by homology search
   "Weber MJ"
   "FEBS J (2005) 272:59-73