Mmu-mir-223 is a microRNA that is upregulated in various biological contexts [PMC5617494]. In CD34+SCA1+ BMHSCs, the expression of mmu-mir-223 was found to be upregulated after treatment with CTX [PMC5617494]. Knocking out mmu-mir-223 resulted in the de-repression of exclusive targets with 8mer sites, indicating that the 5'-isomiR of mmu-mir-223 affected these targets [PMC3919606]. The expression levels of mmu-mir-223 were normalized against β-actin [PMC4755013]. In UVB irradiated mice, mmu-mir-223 was found to be upregulated compared to untreated mice [PMC3597329]. Mice with DSS-induced colitis were treated with mmu-mir-223 loaded nanoparticles, which resulted in therapeutic effects [PMC9024817]. Mmu-mir-223 mimic treatment repressed the expression of NLRP3 and increased the repression of IL-1β, IL-6, TNF-α, and CXCL1 and CXCL2 mRNA transcripts [PMC6113393]. G1 arrest and the presence of p27 regulated three miRs including mir233 [PMC4012735]. Several miRNAs including mir233 increased their expression significantly at different times post-infection [PMC9861972].
u ccaucu - u cC U GAGUUG u cugg gca g gucacgcu G GUAUUUGACAAGCU gacacucug g |||| ||| | |||||||| | |||||||||||||| ||||||||| u gacu cgu c cgguguga C CAUAAACUGUUUGA CUGUgagau g - ---auc a u AC C ------ g
Accession | MIMAT0017056 |
Description | Mus musculus mmu-miR-223-5p mature miRNA |
Sequence | 26 - CGUGUAUUUGACAAGCUGAGUUG - 48 |
Evidence |
experimental
Illumina [5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0000665 |
Description | Mus musculus mmu-miR-223-3p mature miRNA |
Sequence | 68 - UGUCAGUUUGUCAAAUACCCCA - 89 |
Evidence |
experimental
cloned [3], Illumina [4-5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|