miRBase entry: mmu-mir-223

Stem-loop mmu-mir-223


Accession
MI0000703
Symbol
MGI: Mir223
Description
Mus musculus mmu-mir-223 precursor miRNA mir-223
Gene
family?
RF00664; mir-223

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Mmu-mir-223 is a microRNA that is upregulated in various biological contexts [PMC5617494]. In CD34+SCA1+ BMHSCs, the expression of mmu-mir-223 was found to be upregulated after treatment with CTX [PMC5617494]. Knocking out mmu-mir-223 resulted in the de-repression of exclusive targets with 8mer sites, indicating that the 5'-isomiR of mmu-mir-223 affected these targets [PMC3919606]. The expression levels of mmu-mir-223 were normalized against β-actin [PMC4755013]. In UVB irradiated mice, mmu-mir-223 was found to be upregulated compared to untreated mice [PMC3597329]. Mice with DSS-induced colitis were treated with mmu-mir-223 loaded nanoparticles, which resulted in therapeutic effects [PMC9024817]. Mmu-mir-223 mimic treatment repressed the expression of NLRP3 and increased the repression of IL-1β, IL-6, TNF-α, and CXCL1 and CXCL2 mRNA transcripts [PMC6113393]. G1 arrest and the presence of p27 regulated three miRs including mir233 [PMC4012735]. Several miRNAs including mir233 increased their expression significantly at different times post-infection [PMC9861972].

Literature search
185 open access papers mention mmu-mir-223
(2051 sentences)

Sequence

516726 reads, 2285 reads per million, 96 experiments
ucuggccaucugcagugucacgcucCGUGUAUUUGACAAGCUGAGUUGgacacucugugugguagagUGUCAGUUUGUCAAAUACCCCAaguguggcucaugccuaucag
.((((......((((.((((((((..(.((((((((((((((......(((((((((.....))))))))))))))))))))))).)..)))))))).).)))...))))

Structure
u    ccaucu   - u        cC U              GAGUUG         u 
 cugg      gca g gucacgcu  G GUAUUUGACAAGCU      gacacucug g
 ||||      ||| | ||||||||  | ||||||||||||||      ||||||||| u
 gacu      cgu c cgguguga  C CAUAAACUGUUUGA      CUGUgagau g
-    ---auc   a u        AC C              ------         g 


Annotation confidence High
Do you think this miRNA is real?
Comments
Mouse mir-223 is predicted [2] based on homology to a reported miR from human (MIR:MI0000300) [1]. Its expression was later verified by cloning [3].

Genome context
chrX: 96242817-96242926 [+]

Database links

Mature mmu-miR-223-5p

Accession MIMAT0017056
Description Mus musculus mmu-miR-223-5p mature miRNA
Sequence 26 - CGUGUAUUUGACAAGCUGAGUUG - 48
Evidence experimental
Illumina [5]
Database links
Predicted targets

Mature mmu-miR-223-3p

Accession MIMAT0000665
Description Mus musculus mmu-miR-223-3p mature miRNA
Sequence 68 - UGUCAGUUUGUCAAAUACCCCA - 89
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  5. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73