miRBase entry: mmu-mir-320

Stem-loop mmu-mir-320


Accession
MI0000704
Symbol
MGI: Mir320
Description
Mus musculus mmu-mir-320 precursor miRNA mir-320
Gene
family?
RF00736; mir-320

Literature search
59 open access papers mention mmu-mir-320
(226 sentences)

Sequence

1234184 reads, 3881 reads per million, 107 experiments
gccucgccgcccuccGCCUUCUCUUCCCGGUUCUUCCcggagucgggAAAAGCUGGGUUGAGAGGGCGAaaaaggauguggg
..(((((..((...(((((((((..(((((((.((((((....)))))).)))))))..))))))))).....))..)))))

Structure
gc     cg  --cuc         UU       C      g 
  cucgc  cc     cGCCUUCUC  CCCGGUU UUCCcg a
  |||||  ||     |||||||||  ||||||| ||||||  
  gggug  gg     GCGGGAGAG  GGGUCGA AAgggc g
--     ua  aaaaA         UU       A      u 


Annotation confidence High
Do you think this miRNA is real?
Comments
Mouse mir-320 is predicted [2] based on homology to a cloned miR from human (MIR:MI0000542) [1]. Its expression was later verified in mouse [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chr14: 70443510-70443591 [+]

Database links

Mature mmu-miR-320-5p

Accession MIMAT0017057
Description Mus musculus mmu-miR-320-5p mature miRNA
Sequence 16 - GCCUUCUCUUCCCGGUUCUUCC - 37
Evidence experimental
Illumina [6]
Database links
Predicted targets

Mature mmu-miR-320-3p

Accession MIMAT0000666
Description Mus musculus mmu-miR-320-3p mature miRNA
Sequence 48 - AAAAGCUGGGUUGAGAGGGCGA - 69
Evidence experimental
cloned [3-4], Illumina [5-6]
Database links
Predicted targets

References

  1. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73