Stem-loop mmu-mir-29b-2

Accession

MI0000712

Symbol

MGI: Mir29b-2

Description

Mus musculus mmu-mir-29b-2 precursor miRNA

Literature search

337 open access papers mention mmu-mir-29b-2
(3455 sentences)

Sequence

205107 reads, 2042 reads per million, 106 experiments

cuucuggaagCUGGUUUCACAUGGUGGCUUAGAUUuuuccaucuuuguaucUAGCACCAUUUGAAAUCAGUGUUuuaggag
(((((((((((((((((((.((((((.((.((((..............)))))))))))).)))))))))).)))))))))

Structure

         -          C      G  U    Uuuucc 
cuucuggaa gCUGGUUUCA AUGGUG CU AGAU      a
||||||||| |||||||||| |||||| || ||||       
gaggauuUU UGACUAAAGU UACCAC GA Ucua      u
         G          U      -  -    uguuuc 

Annotation confidence High

Genome context

chr1: 195037040-195037120 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from mmu-mir-29b-2

Mature mmu-miR-29b-3p

• Accession: MIMAT0000127
• Description: Mus musculus mmu-miR-29b-3p mature miRNA
• Sequence: 52 - UAGCACCAUUUGAAAUCAGUGUU - 74
• Evidence: experimental ; cloned [1,3,5], Illumina [6,8]

Mature mmu-miR-29b-2-5p

• Accession: MIMAT0017063
• Description: Mus musculus mmu-miR-29b-2-5p mature miRNA
• Sequence: 11 - CUGGUUUCACAUGGUGGCUUAGAUU - 35
• Evidence: experimental ; 454 [7], Illumina [8]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12919684
   Embryonic stem cell-specific MicroRNAs
   "Houbaviy HB, Murray MF, Sharp PA"
   "Dev Cell (2003) 5:351-358


3. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739


4. PubMed ID: 15538371
   A pancreatic islet-specific microRNA regulates insulin secretion
   "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
   "Nature (2004) 432:226-230


5. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


6. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


7. PubMed ID: 15634332
   New human and mouse microRNA genes found by homology search
   "Weber MJ"
   "FEBS J (2005) 272:59-73


8. PubMed ID: 20668074
   Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
   "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
   "J Virol (2010) 84:10266-10275