Stem-loop mmu-mir-125b-1

Accession

MI0000725

Symbol

MGI: Mir125b-1

Description

Mus musculus mmu-mir-125b-1 precursor miRNA

Literature search

258 open access papers mention mmu-mir-125b-1
(1476 sentences)

Sequence

1699627 reads, 11761 reads per million, 113 experiments

ugcgcuccccucagUCCCUGAGACCCUAACUUGUGAuguuuaccguuuaaauccACGGGUUAGGCUCUUGGGAGCUg
...........((((.(((((((.(((((((((((..(((((.....))))).))))))))))).))))))).))))

Structure

ugcgcuccccu    C       C           Au     c 
           cagU CCUGAGA CCUAACUUGUG  guuua c
           |||| ||||||| |||||||||||  ||||| g
           gUCG GGGUUCU GGAUUGGGCAc  uaaau u
-----------    A       C           -c     u 

Annotation confidence High

Genome context

chr9: 41581926-41582002 [+]

Mature mmu-miR-125b-5p

• Accession: MIMAT0000136
• Description: Mus musculus mmu-miR-125b-5p mature miRNA
• Sequence: 15 - UCCCUGAGACCCUAACUUGUGA - 36
• Evidence: experimental ; cloned [1,3-4], Illumina [5-6]

Mature mmu-miR-125b-1-3p

• Accession: MIMAT0004669
• Description: Mus musculus mmu-miR-125b-1-3p mature miRNA
• Sequence: 55 - ACGGGUUAGGCUCUUGGGAGCU - 76
• Evidence: experimental ; cloned [4], Illumina [5-6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739


3. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


4. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


5. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


6. PubMed ID: 15634332
   New human and mouse microRNA genes found by homology search
   "Weber MJ"
   "FEBS J (2005) 272:59-73