MIR128-2 is a miRNA that has been found to be recurrently aberrant in expression in various studies [PMC3566410]. Mutant TP53 has been shown to bind to the putative promoter of the MIR128-2 host gene ARPP21, leading to increased expression of both miR-128 and ARPP21 mRNA [PMC4302087]. A mutation in the MIR128-2 gene, specifically the A13G mutation, has been found to reduce the processing of pri-miR-128-2 and result in glucocorticoid resistance in t(4;11) ALL cells [PMC9406077]. Additionally, mutp53 R175H has been shown to induce the expression of MIR128-2, which targets E2F5 and confers resistance to various cancer treatments [PMC7749743]. MIR128-1 and MIR128-2 are members of the miRNA MIR128 family and encode the same mature miR-128, which plays different roles in tumorigenesis depending on cancer type [PMC7802300]. A three-miRNA signature called miGISig, which includes MIR421, MIR128-1, and MIR128-2, has been identified as predictive of gastrointestinal (GI) cancer and clinical outcome [PMC7802300]. Dysregulation of both MIR128-1 and MIR128-2 has also been observed in glioblastomas [PMC3821381]. The genes encoding miR-128 transcripts are located on different chromosomes (MIR128 family on chromosome 3p22; ARPP21 gene on chromosome 3p22) but encode identical mature sequences with slight differences in their 5p species [PMC5481840].
ugu a AUA AC g gag gcaguggg agGGGGGCCG CACUGU GAGA u u |||||||| |||||||||| |||||| |||| | ugucaucc UUUCUCUGGC GUGACA CUcu g a cug c CAA -- g acg
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000424 |
Description | Homo sapiens hsa-miR-128-3p mature miRNA |
Sequence | 52 - UCACAGUGAACCGGUCUCUUU - 72 |
Evidence |
experimental
cloned [3], Illumina [4] |
Database links | |
Predicted targets |
Accession | MIMAT0031095 |
Description | Homo sapiens hsa-miR-128-2-5p mature miRNA |
Sequence | 15 - GGGGGCCGAUACACUGUACGAGA - 37 |
Evidence |
experimental
Illumina [4] |
|