miRBase entry: hsa-mir-194-2

Stem-loop hsa-mir-194-2


Accession
MI0000732
Symbol
HGNC: MIR194-2
Description
Homo sapiens hsa-mir-194-2 precursor miRNA mir-194
Gene
family?
RF00257; mir-194

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR194-2 is a microRNA (miRNA) that is part of the MIR192-194-2 cluster located on chromosome 11q13.1 and is known to be upregulated in response to p53 activation [PMC6120784]. This miRNA shares an identical mature sequence with MIR194-1, despite being located on different chromosomes, and they both target the same mRNAs [PMC6120784]. In a study comparing squamous and Barrett’s groups, differences in methylation levels of MIR192 and MIR194-2 were observed using the Mann-Whitney test [PMC6120784]. The study also noted an increased coexpression of MIR192 and MIR194-2 in Barrett’s Esophagus (BE), prompting investigations into genomic and epigenetic alterations that could explain this phenomenon [PMC6120784]. Furthermore, MIR194-2 has been identified as part of a molecular feature group with a significant negative correlation with certain transcriptional modules [PMC8360386]. It has also demonstrated good diagnostic performance for certain conditions, with high area under the receiver operating characteristic (AUROC) values [PMC6005310]. Additionally, single nucleotide polymorphisms (SNPs) in MIR194-2 have been associated with differential expression in diseases such as lung cancer [PMC3143163], while its expression alongside other miRNAs has been implicated in the regulation of genes important for various cellular processes [PMC7465068]. Notably, alterations in the levels of this miRNA have been suggested as potential biomarkers for diseases like epilepsy due to its differential expression patterns observed in patients compared to controls [PMC7465068].

Literature search
142 open access papers mention hsa-mir-194-2
(1015 sentences)

Sequence

60143 reads, 96 reads per million, 148 experiments
ugguucccgcccccUGUAACAGCAACUCCAUGUGGAagugcccacugguuCCAGUGGGGCUGCUGUUAUCUGgggcgagggccag
((((((.((((((..(((((((((.((((((.((((...(((....))))))))))))).)))))))))..)))))).)))))).

Structure
-      c      cU         A      G    agu   c 
 ugguuc cgcccc  GUAACAGCA CUCCAU UGGA   gcc a
 |||||| ||||||  ||||||||| |||||| ||||   |||  
 accggg gcgggG  UAUUGUCGU GGGGUG ACCu   ugg c
g      a      UC         C      -    ---   u 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-194 in human [2]. Two putative pairs of orthologous hairpin precursors structures are found in mouse (mir-194-1 (MIR:MI0000236) on chromosome 1, and mir-194-2 (MIR:MI0000733) on chromosome 19) and human (mir-194-1 (MIR:MI0000488) on chromosome 1, and mir-194-2 (MIR:MI0000732) on chromosome 11).

Genome context
chr11: 64891355-64891439 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-194-2
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-194-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-194-5p

Accession MIMAT0000460
Description Homo sapiens hsa-miR-194-5p mature miRNA
Sequence 15 - UGUAACAGCAACUCCAUGUGGA - 36
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-194-3p

Accession MIMAT0004671
Description Homo sapiens hsa-miR-194-3p mature miRNA
Sequence 51 - CCAGUGGGGCUGCUGUUAUCUG - 72
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179