WARNING: This summary was generated by AI. MIR194-2 is a microRNA (miRNA) that is part of the MIR192-194-2 cluster located on chromosome 11q13.1 and is known to be upregulated in response to p53 activation [PMC6120784]. This miRNA shares an identical mature sequence with MIR194-1, despite being located on different chromosomes, and they both target the same mRNAs [PMC6120784]. In a study comparing squamous and Barrett’s groups, differences in methylation levels of MIR192 and MIR194-2 were observed using the Mann-Whitney test [PMC6120784]. The study also noted an increased coexpression of MIR192 and MIR194-2 in Barrett’s Esophagus (BE), prompting investigations into genomic and epigenetic alterations that could explain this phenomenon [PMC6120784]. Furthermore, MIR194-2 has been identified as part of a molecular feature group with a significant negative correlation with certain transcriptional modules [PMC8360386]. It has also demonstrated good diagnostic performance for certain conditions, with high area under the receiver operating characteristic (AUROC) values [PMC6005310]. Additionally, single nucleotide polymorphisms (SNPs) in MIR194-2 have been associated with differential expression in diseases such as lung cancer [PMC3143163], while its expression alongside other miRNAs has been implicated in the regulation of genes important for various cellular processes [PMC7465068]. Notably, alterations in the levels of this miRNA have been suggested as potential biomarkers for diseases like epilepsy due to its differential expression patterns observed in patients compared to controls [PMC7465068].
- c cU A G agu c ugguuc cgcccc GUAACAGCA CUCCAU UGGA gcc a |||||| |||||| ||||||||| |||||| |||| ||| accggg gcgggG UAUUGUCGU GGGGUG ACCu ugg c g a UC C - --- u
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000460 |
| Description | Homo sapiens hsa-miR-194-5p mature miRNA |
| Sequence | 15 - UGUAACAGCAACUCCAUGUGGA - 36 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004671 |
| Description | Homo sapiens hsa-miR-194-3p mature miRNA |
| Sequence | 51 - CCAGUGGGGCUGCUGUUAUCUG - 72 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
|