miRBase entry: mmu-mir-194-2

Stem-loop mmu-mir-194-2


Accession
MI0000733
Symbol
MGI: Mir194-2
Description
Mus musculus mmu-mir-194-2 precursor miRNA mir-194
Gene
family?
RF00257; mir-194

Literature search
56 open access papers mention mmu-mir-194-2
(243 sentences)

Sequence

180618 reads, 970 reads per million, 103 experiments
guggcucccacccucUGUAACAGCAACUCCAUGUGGAagugcccacugguuCCAGUGGGGCUGCUGUUAUCUGggguggcggcuag
.(((((.(((((((..(((((((((.((((((.((((...(((....))))))))))))).)))))))))..))))))).))))).

Structure
g     c       cU         A      G    agu   c 
 uggcu ccacccu  GUAACAGCA CUCCAU UGGA   gcc a
 ||||| |||||||  ||||||||| |||||| ||||   |||  
 aucgg ggugggG  UAUUGUCGU GGGGUG ACCu   ugg c
g     c       UC         C      -    ---   u 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
Lagos-Quintana cloned miR-194 from mouse kidney tissue [1]. Michael et al. subsequently verified expression of miR-194 in human [2]. Two putative pairs of orthologous hairpin precursors structures are found in mouse (mir-194-1 (MIR:MI0000236) on chromosome 1, and mir-194-2 (MIR:MI0000733) on chromosome 19) and human (mir-194-1 (MIR:MI0000488) on chromosome 1, and mir-194-2 (MIR:MI0000732) on chromosome 11).

Genome context
chr19: 6264643-6264728 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-194-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-194-5p

Accession MIMAT0000224
Description Mus musculus mmu-miR-194-5p mature miRNA
Sequence 16 - UGUAACAGCAACUCCAUGUGGA - 37
Evidence experimental
cloned [1,3], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-194-2-3p

Accession MIMAT0017073
Description Mus musculus mmu-miR-194-2-3p mature miRNA
Sequence 52 - CCAGUGGGGCUGCUGUUAUCUG - 73
Evidence experimental
Illumina [5]
Database links
Predicted targets

References

  1. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009