miRBase entry: hsa-mir-29c

Stem-loop hsa-mir-29c


Accession
MI0000735
Symbol
HGNC: MIR29C
Description
Homo sapiens hsa-mir-29c precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR29C is a microRNA that is involved in various biological processes [PMC6219092]. It has been found that suppression of MIR29C in goose fatty liver promotes cell growth and enhances tolerance to severe steatosis [PMC6219092]. The expression of MIR29C is elevated in lncRNA HOXA-AS3 knockdown cell lines [PMC8489150]. Furthermore, the transcription factor MYC represses the expression of MIR29C, leading to increased expression of MCT1 on tumor cells [PMC5406861]. Two mRNA, VEGFA and SERPINE1, are regulated by multiple microRNAs including MIR29C [PMC5770416]. These microRNAs, including MIR29C, can be combined as a panel to predict hepatocellular carcinoma using a calculation formula [PMC9537616].

Literature search
512 open access papers mention hsa-mir-29c
(2674 sentences)

Sequence

388191 reads, 2141 reads per million, 135 experiments
aucucuuacacaggcUGACCGAUUUCUCCUGGUGUUCagagucuguuuuugucUAGCACCAUUUGAAAUCGGUUAugauguaggggga
..((((((((((...(((((((((((...(((((((.(((...........))))))))))...))))))))))))).))))))))..

Structure
au        -  ggc           UCC       C   gucu 
  cucuuaca ca   UGACCGAUUUC   UGGUGUU aga    g
  |||||||| ||   |||||||||||   ||||||| |||    u
  ggggaugu gu   AUUGGCUAAAG   ACCACGA Ucu    u
ag        a  ---           UUU       -   guuu 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr1: 207801852-207801939 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-29c
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-29c is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-29c-5p

Accession MIMAT0004673
Description Homo sapiens hsa-miR-29c-5p mature miRNA
Sequence 16 - UGACCGAUUUCUCCUGGUGUUC - 37
Evidence experimental
cloned [3]
Database links
Predicted targets

Mature hsa-miR-29c-3p

Accession MIMAT0000681
Description Homo sapiens hsa-miR-29c-3p mature miRNA
Sequence 54 - UAGCACCAUUUGAAAUCGGUUA - 75
Evidence experimental
cloned [2-4]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739