miRBase entry: hsa-mir-29c

Stem-loop hsa-mir-29c


Accession
MI0000735
Symbol
HGNC: MIR29C
Description
Homo sapiens hsa-mir-29c precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR29C is a microRNA implicated in various cellular processes, including cell growth and the regulation of gene expression. Suppression of MIR29C in goose fatty liver is associated with increased tolerance to severe steatosis, suggesting a role in promoting cell growth during the overfeeding period [PMC6219092]. The expression of MIR29C is upregulated when lncRNA HOXA-AS3 is knocked down, indicating a regulatory relationship between these non-coding RNAs [PMC8489150]. Furthermore, MIR29C, along with miR29a, is transcriptionally repressed by the oncogene MYC, which consequently leads to increased expression of the monocarboxylate transporter 1 (MCT1) on tumor cells [PMC5406861]. Additionally, MIR29C is involved in the regulation of VEGFA mRNA levels and has been identified as part of a miRNA panel that can be used to calculate the probability of hepatocellular carcinoma (HCC) using a specific formula [PMC5770416; PMC9537616].. This panel includes other microRNAs and provides insight into how multiple miRNAs can cooperatively regulate gene expression and contribute to disease processes.

Literature search
512 open access papers mention hsa-mir-29c
(2674 sentences)

Sequence

388191 reads, 1460 reads per million, 135 experiments
aucucuuacacaggcUGACCGAUUUCUCCUGGUGUUCagagucuguuuuugucUAGCACCAUUUGAAAUCGGUUAugauguaggggga
..((((((((((...(((((((((((...(((((((.(((...........))))))))))...))))))))))))).))))))))..

Structure
au        -  ggc           UCC       C   gucu 
  cucuuaca ca   UGACCGAUUUC   UGGUGUU aga    g
  |||||||| ||   |||||||||||   ||||||| |||    u
  ggggaugu gu   AUUGGCUAAAG   ACCACGA Ucu    u
ag        a  ---           UUU       -   guuu 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr1: 207801852-207801939 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-29c
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-29c is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-29c-5p

Accession MIMAT0004673
Description Homo sapiens hsa-miR-29c-5p mature miRNA
Sequence 16 - UGACCGAUUUCUCCUGGUGUUC - 37
Evidence experimental
cloned [3]
Database links
Predicted targets

Mature hsa-miR-29c-3p

Accession MIMAT0000681
Description Homo sapiens hsa-miR-29c-3p mature miRNA
Sequence 54 - UAGCACCAUUUGAAAUCGGUUA - 75
Evidence experimental
cloned [2-4]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739