MIR34C is a microRNA implicated in the regulation of gene expression, including the gene Bcl-2, which is known to play a role in cell survival and apoptosis [PMC4067617]. In a study where embryos were treated with VFm34cI, an inhibitor of MIR34C, an increase in Bcl-2 expression was observed on the first day post-treatment [PMC4067617]. This suggests that the VisuFect-mediated delivery of MIR34C inhibitor was successful and that the inhibitor was functioning effectively within the zygotes [PMC4067617]. Additionally, to assess the impact of Zika virus infection on MIR34C expression levels, real-time PCR assays were conducted on three different clones [PMC6425033]. This analysis confirmed that Zika infection induces changes in MIR34C expression [PMC6425033], which could have implications for understanding how Zika virus affects embryonic development and gene regulation.
a ag A A A C C a gucu uuacu GGC GUGU GUUAG UGAUUG ua u |||| ||||| ||| |||| ||||| |||||| || uaga aauGG CCG CACA CAAUC ACUAAc au a u aa A G C - c g
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000686 |
Description | Homo sapiens hsa-miR-34c-5p mature miRNA |
Sequence | 13 - AGGCAGUGUAGUUAGCUGAUUGC - 35 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004677 |
Description | Homo sapiens hsa-miR-34c-3p mature miRNA |
Sequence | 46 - AAUCACUAACCACACGGCCAGG - 67 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|