MIR99B is a microRNA that is part of the human transcriptional unit AY358799, located downstream of a cluster of three microRNAs (MIR99B, LET7E, miR125A) [PMC3783845]. Blocking the expression of MIR99B has been shown to restrict bacterial growth [PMC3576108]. MIR99B is highly expressed and an outlier in the distribution array [PMC7912193]. It targets several genes and is the second most expressed miRNA [PMC7912193]. MIR99B has been found in EVs and is associated with pancreatic cancer cells and AML cell-derived EXs [PMC9171400] [PMC7100658]. It has also been implicated in breast cancer metastases, endometrial cancer, and NASH [PMC5705145] [PMC6994408] [PMC9818030]. MIR99B has been shown to target IGF1R and participate in the shutdown of signal transduction pathways involving NF-κB pathways [PMC4290566]. It is part of a cluster with MIR125A and MIR7E on chromosome 19 [PMC3573016] and has been found to be upregulated in CF airway epithelial cell lines compared to non-CF controls [PMC7493015]. The functionality of MIR99B has been associated with carcinogenesis, as dysregulation of both mature miRNAs produced by MIR99B (hsa-miR-99b-3p and hsa-miR-99b-5p) have been linked to cancer development. Mutations within miRNAs can also be associated with cancer development. The role of MIR99B in macrophage activation regulation remains complex.
cC AC C --C g c ggcac ACCCGUAGA CGA CUUG G ggc u ||||| ||||||||| ||| |||| | ||| cuguG UGGGUGUCU GCU GAAC c ccg u CC GU C aca g c
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000689 |
Description | Homo sapiens hsa-miR-99b-5p mature miRNA |
Sequence | 7 - CACCCGUAGAACCGACCUUGCG - 28 |
Evidence |
experimental
cloned [4-6] |
Database links | |
Predicted targets |
Accession | MIMAT0004678 |
Description | Homo sapiens hsa-miR-99b-3p mature miRNA |
Sequence | 45 - CAAGCUCGUGUCUGUGGGUCCG - 66 |
Evidence |
experimental
cloned [5] |
Database links | |
Predicted targets |
|