miRBase entry: hsa-mir-99b

Stem-loop hsa-mir-99b


Accession
MI0000746
Symbol
HGNC: MIR99B
Description
Homo sapiens hsa-mir-99b precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR99B is a microRNA located just downstream of a cluster of microRNAs on the human transcriptional unit AY358799 and is highly expressed in various biological contexts [PMC3783845], [PMC7912193]. It plays a role in the immune response by restricting bacterial growth when its expression is blocked [PMC3576108]. Despite its high expression levels, MIR99B, along with other frequently expressed miRNAs, targets fewer genes compared to less expressed miRNAs [PMC7912193]. It has been identified in extracellular vesicles (EVs) and is the second most expressed miRNA within them, suggesting its potential role in intercellular communication [PMC7912193]. MIR99B has been implicated in the regulation of insulin-like growth factor 1 receptor (IGF1R) and may contribute to a coordinated shutdown of signal transduction pathways that block NF-κB pathways [PMC4290566]. In various diseases, MIR99B expression levels differ; it is upregulated in cystic fibrosis airway epithelial cells and downregulated in endometrial cancer cells, indicating its complex role as both a potential tumor suppressor and as part of the body's response to certain diseases [PMC7493015], [PMC6994408]. Furthermore, MIR99B has been engineered into an adenovirus to enhance antitumoral activity against pancreatic cancer cells, highlighting its therapeutic potential [PMC9171400].

Literature search
137 open access papers mention hsa-mir-99b
(407 sentences)

Sequence

662095 reads, 1203 reads per million, 130 experiments
ggcaccCACCCGUAGAACCGACCUUGCGgggccuucgccgcacaCAAGCUCGUGUCUGUGGGUCCGuguc
(((((..(((((((((..(((.((((.(.(((....))).)...)))).)))..)))))))))..)))))

Structure
     cC         AC   C    --C g   c 
ggcac  ACCCGUAGA  CGA CUUG   G ggc u
|||||  |||||||||  ||| ||||   | |||  
cuguG  UGGGUGUCU  GCU GAAC   c ccg u
     CC         GU   C    aca g   c 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence is the predicted human homologue of mouse miR-99b, cloned from mouse brain [1] and embryonic stem cells [2,3]. Its expression was later validated in human [4-6].

Genome context
chr19: 51692612-51692681 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-99b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-99b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-99b-5p

Accession MIMAT0000689
Description Homo sapiens hsa-miR-99b-5p mature miRNA
Sequence 7 - CACCCGUAGAACCGACCUUGCG - 28
Evidence experimental
cloned [4-6]
Database links
Predicted targets

Mature hsa-miR-99b-3p

Accession MIMAT0004678
Description Homo sapiens hsa-miR-99b-3p mature miRNA
Sequence 45 - CAAGCUCGUGUCUGUGGGUCCG - 66
Evidence experimental
cloned [5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854

  4. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  5. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73