miRBase entry: hsa-mir-296

Stem-loop hsa-mir-296


Accession
MI0000747
Symbol
HGNC: MIR296
Description
Homo sapiens hsa-mir-296 precursor miRNA mir-296
Gene
family?
RF00733; mir-296

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR296 is a microRNA implicated in various biological processes and diseases [PMC4464490]. It is one of the imprinted genes, with a mean methylation value of 0.95 ± 0.05 in normal donors, but is found to be hypomethylated in the majority of oral squamous cell carcinoma (OSCC) cases [PMC6123335], [PMC5558660]. This microRNA has been identified as upregulated and its seed sequences are complementary to those in hepatitis C virus (HCV) RNA [PMC9780829]. It has been detected in specific cell lines such as GM12878 and MCF7, suggesting a degree of cell type-specific expression [PMC6824518]. MIR296 is also differentially expressed during embryonic development, being present in mesoderm and endoderm but not ectoderm tissues [PMC8713755]. Furthermore, it has been shown to modulate core stemness factors like Oct4, Nanog, and Sox2, influencing the self-renewal and differentiation of embryonic stem cells as well as being implicated in cancer progression through targeting Nanog [PMC3772775]. In addition to its role within cells, MIR296 is also found within extracellular vesicles (EVs) derived from periodontal ligament stem cells (PDLSCs), indicating its potential role in intercellular communication [PMC8745761]. Despite these findings, preliminary experiments have shown no significant modulation of MIR296 expression under certain conditions [PMC9603196], indicating that its expression may be context-dependent. Notably, it has been identified with a significant upregulation (33-fold) in certain cell lines carrying specific genetic variations [PMC4695081].

Literature search
83 open access papers mention hsa-mir-296
(498 sentences)

Sequence

5973 reads, 47 reads per million, 90 experiments
aggacccuuccagAGGGCCCCCCCUCAAUCCUGUugugccuaauucaGAGGGUUGGGUGGAGGCUCUCCugaagggcucu
.(((((((((..(((((((.((.(((((((((.(((.........)))))))))))).)).)))))))..)))))).)))

Structure
a   -      ca       C  C         G   ugc 
 gga cccuuc  gAGGGCC CC CUCAAUCCU Uug   c
 ||| ||||||  ||||||| || ||||||||| |||   u
 ucu gggaag  CUCUCGG GG GGGUUGGGA Gac   a
-   c      uC       A  U         -   uua 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
This sequence is the predicted human homologue of mouse miR-296 cloned from mouse embryonic stem cells [1,3]. Its expression has also been verified in human ES cells [2].

Genome context
chr20: 58817615-58817694 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-296
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-296 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-296-5p

Accession MIMAT0000690
Description Homo sapiens hsa-miR-296-5p mature miRNA
Sequence 14 - AGGGCCCCCCCUCAAUCCUGU - 34
Evidence experimental
cloned [2,4-5]
Database links
Predicted targets

Mature hsa-miR-296-3p

Accession MIMAT0004679
Description Homo sapiens hsa-miR-296-3p mature miRNA
Sequence 48 - GAGGGUUGGGUGGAGGCUCUCC - 69
Evidence experimental
cloned [4]
Database links
Predicted targets

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  5. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73