MIR296 is an imprinted gene that has been studied in various contexts. It has been found to be hypomethylated in most cases of oral squamous cell carcinoma (OSCC) [PMC5558660]. Additionally, MIR296 has been identified as one of the miRNAs that have complementary sequences to HCV RNA [PMC9780829]. It has also been detected in GM12878 and MCF7 cells, as predicted by read-through transcription units [PMC6824518]. Dysregulation of MIR296 has been observed in the placenta of preeclampsia patients [PMC4464490]. Furthermore, MIR296 is one of the miRNAs found in extracellular vesicles (EVs) derived from periodontal ligament stem cells (PDLSCs) [PMC8745761]. In developmental studies, MIR296 and Mir298 were expressed in mesoderm and endoderm but not ectoderm [PMC8713755]. In stem cells, miR470, along with miR134 and MIR296, plays a role in modulating self-renewal and differentiation by targeting core stemness factors such as Oct4 and Nanog [PMC3772775]. The expression of MIR296 has also been investigated in acute promyelocytic leukemia (APL), with the aim of predicting prognosis [PMC8993542]. Finally, it was found that MIR296 is upregulated 33-fold in cells with a specific genetic variant (MIR204SNP) [PMC4695081].
a - ca C C G ugc gga cccuuc gAGGGCC CC CUCAAUCCU Uug c ||| |||||| ||||||| || ||||||||| ||| u ucu gggaag CUCUCGG GG GGGUUGGGA Gac a - c uC A U - uua
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000690 |
Description | Homo sapiens hsa-miR-296-5p mature miRNA |
Sequence | 14 - AGGGCCCCCCCUCAAUCCUGU - 34 |
Evidence |
experimental
cloned [2,4-5] |
Database links | |
Predicted targets |
Accession | MIMAT0004679 |
Description | Homo sapiens hsa-miR-296-3p mature miRNA |
Sequence | 48 - GAGGGUUGGGUGGAGGCUCUCC - 69 |
Evidence |
experimental
cloned [4] |
Database links | |
Predicted targets |
|