MIR296 is a microRNA implicated in various biological processes and diseases [PMC4464490]. It is one of the imprinted genes, with a mean methylation value of 0.95 ± 0.05 in normal donors, but is found to be hypomethylated in the majority of oral squamous cell carcinoma (OSCC) cases [PMC6123335], [PMC5558660]. This microRNA has been identified as upregulated and its seed sequences are complementary to those in hepatitis C virus (HCV) RNA [PMC9780829]. It has been detected in specific cell lines such as GM12878 and MCF7, suggesting a degree of cell type-specific expression [PMC6824518]. MIR296 is also differentially expressed during embryonic development, being present in mesoderm and endoderm but not ectoderm tissues [PMC8713755]. Furthermore, it has been shown to modulate core stemness factors like Oct4, Nanog, and Sox2, influencing the self-renewal and differentiation of embryonic stem cells as well as being implicated in cancer progression through targeting Nanog [PMC3772775]. In addition to its role within cells, MIR296 is also found within extracellular vesicles (EVs) derived from periodontal ligament stem cells (PDLSCs), indicating its potential role in intercellular communication [PMC8745761]. Despite these findings, preliminary experiments have shown no significant modulation of MIR296 expression under certain conditions [PMC9603196], indicating that its expression may be context-dependent. Notably, it has been identified with a significant upregulation (33-fold) in certain cell lines carrying specific genetic variations [PMC4695081].
a - ca C C G ugc gga cccuuc gAGGGCC CC CUCAAUCCU Uug c ||| |||||| ||||||| || ||||||||| ||| u ucu gggaag CUCUCGG GG GGGUUGGGA Gac a - c uC A U - uua
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000690 |
Description | Homo sapiens hsa-miR-296-5p mature miRNA |
Sequence | 14 - AGGGCCCCCCCUCAAUCCUGU - 34 |
Evidence |
experimental
cloned [2,4-5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004679 |
Description | Homo sapiens hsa-miR-296-3p mature miRNA |
Sequence | 48 - GAGGGUUGGGUGGAGGCUCUCC - 69 |
Evidence |
experimental
cloned [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|