WARNING: This summary was generated by AI. MIR30E is a microRNA that has been identified as dysregulated in the plasma of schizophrenia patients, suggesting a potential role in the pathophysiology of the disorder [PMC4977811]. It is one of several microRNAs that have been found to be altered in patients, indicating that microRNA dysregulation could be a feature of schizophrenia [PMC4977811]. Notably, MIR30E is co-located with mir30c-1 within an intron of the Nfyc gene, which is an interesting genomic context as this gene's promoter region contains a CpG island [PMC6195825]. The presence of MIR30E within this particular genomic region could imply regulatory mechanisms involving epigenetic modifications that are relevant to schizophrenia and warrant further investigation [PMC6195825].
g uu a UU g aag u ggcagucu gcu cUGUAAACAUCC GACUGGAAGcu u g g |||||||| ||| |||||||||||| ||||||||||| | | ccgucgga cgg GACAUUUGUAGG CUGACUUUCga g c u a -- C -- g aga u
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Accession | MIMAT0000692 |
| Description | Homo sapiens hsa-miR-30e-5p mature miRNA |
| Sequence | 17 - UGUAAACAUCCUUGACUGGAAG - 38 |
| Evidence |
experimental
cloned [3,5-6] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000693 |
| Description | Homo sapiens hsa-miR-30e-3p mature miRNA |
| Sequence | 59 - CUUUCAGUCGGAUGUUUACAGC - 80 |
| Evidence |
experimental
cloned [3,5] |
| Database links |
|
| Predicted targets |
|
|