miRBase entry: hsa-mir-30e

Stem-loop hsa-mir-30e


Accession
MI0000749
Symbol
HGNC: MIR30E
Description
Homo sapiens hsa-mir-30e precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR30E is a dysregulated microRNA found in the plasma of schizophrenia patients [PMC4977811]. In a study, it was identified along with several other dysregulated microRNAs, including miR-181b, miR219-2-3p, miR346, miR195, miR1308, miR92a, miR17, mirR103, let-7g, mir34a, and mir7 [PMC4977811]. Additionally, the study identified five potential new microRNAs in this field [PMC4977811]. MIR30E is located within the same intron of the Nfyc gene and shares this location with Mir30c-1 [PMC6195825]. The Nfyc gene contains a CpG island in its promoter region [PMC6195825].

Literature search
357 open access papers mention hsa-mir-30e
(1687 sentences)

Sequence

736258 reads, 2874 reads per million, 149 experiments
gggcagucuuugcuacUGUAAACAUCCUUGACUGGAAGcuguaagguguucagaggagCUUUCAGUCGGAUGUUUACAGCggcaggcugcca
.((((((((..(((.((((((((((((..(((((((((((.(...(....)...).))))))))))))))))))))))).))))))))))).

Structure
g        uu   a            UU           g aag u 
 ggcagucu  gcu cUGUAAACAUCC  GACUGGAAGcu u   g g
 ||||||||  ||| ||||||||||||  ||||||||||| |   |  
 ccgucgga  cgg GACAUUUGUAGG  CUGACUUUCga g   c u
a        --   C            --           g aga u 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence is the predicted human homologue of mouse miR-30e [1,2,4]. Mature products from both arms of the precursor (hsa-miR-30e-5p and hsa-miR-30e-3p) were later independently verified in human myelocytic leukemia (HL-60) cells [3]. Landgraf et al. later showed that the 5' product is the predominant one [5]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context
chr1: 40754355-40754446 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-30e
Name Accession Chromosome Start End Strand Confidence




Database links

Mature hsa-miR-30e-5p

Accession MIMAT0000692
Description Homo sapiens hsa-miR-30e-5p mature miRNA
Sequence 17 - UGUAAACAUCCUUGACUGGAAG - 38
Evidence experimental
cloned [3,5-6]
Database links
Predicted targets

Mature hsa-miR-30e-3p

Accession MIMAT0000693
Description Homo sapiens hsa-miR-30e-3p mature miRNA
Sequence 59 - CUUUCAGUCGGAUGUUUACAGC - 80
Evidence experimental
cloned [3,5]
Database links
Predicted targets

References

  1. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  5. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73