miRBase entry: hsa-mir-30e

Stem-loop hsa-mir-30e


Accession
MI0000749
Symbol
HGNC: MIR30E
Description
Homo sapiens hsa-mir-30e precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR30E is a microRNA that has been identified as dysregulated in the plasma of schizophrenia patients, suggesting a potential role in the pathophysiology of the disorder [PMC4977811]. It is one of several microRNAs that have been found to be altered in patients, indicating that microRNA dysregulation could be a feature of schizophrenia [PMC4977811]. Notably, MIR30E is co-located with mir30c-1 within an intron of the Nfyc gene, which is an interesting genomic context as this gene's promoter region contains a CpG island [PMC6195825]. The presence of MIR30E within this particular genomic region could imply regulatory mechanisms involving epigenetic modifications that are relevant to schizophrenia and warrant further investigation [PMC6195825].

Literature search
357 open access papers mention hsa-mir-30e
(1687 sentences)

Sequence

736242 reads, 2049 reads per million, 149 experiments
gggcagucuuugcuacUGUAAACAUCCUUGACUGGAAGcuguaagguguucagaggagCUUUCAGUCGGAUGUUUACAGCggcaggcugcca
.((((((((..(((.((((((((((((..(((((((((((.(...(....)...).))))))))))))))))))))))).))))))))))).

Structure
g        uu   a            UU           g aag u 
 ggcagucu  gcu cUGUAAACAUCC  GACUGGAAGcu u   g g
 ||||||||  ||| ||||||||||||  ||||||||||| |   |  
 ccgucgga  cgg GACAUUUGUAGG  CUGACUUUCga g   c u
a        --   C            --           g aga u 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence is the predicted human homologue of mouse miR-30e [1,2,4]. Mature products from both arms of the precursor (hsa-miR-30e-5p and hsa-miR-30e-3p) were later independently verified in human myelocytic leukemia (HL-60) cells [3]. Landgraf et al. later showed that the 5' product is the predominant one [5]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context
chr1: 40754355-40754446 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-30e
Name Accession Chromosome Start End Strand Confidence




Database links

Mature hsa-miR-30e-5p

Accession MIMAT0000692
Description Homo sapiens hsa-miR-30e-5p mature miRNA
Sequence 17 - UGUAAACAUCCUUGACUGGAAG - 38
Evidence experimental
cloned [3,5-6]
Database links
Predicted targets

Mature hsa-miR-30e-3p

Accession MIMAT0000693
Description Homo sapiens hsa-miR-30e-3p mature miRNA
Sequence 59 - CUUUCAGUCGGAUGUUUACAGC - 80
Evidence experimental
cloned [3,5]
Database links
Predicted targets

References

  1. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  5. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73