miRBase entry: hsa-mir-26a-2

Stem-loop hsa-mir-26a-2


Accession
MI0000750
Symbol
HGNC: MIR26A2
Description
Homo sapiens hsa-mir-26a-2 precursor miRNA mir-26
Gene
family?
RF00244; mir-26

Literature search
449 open access papers mention hsa-mir-26a-2
(1881 sentences)

Sequence

17663901 reads, 30054.0 reads per million, 197 experiments
ggcuguggcuggaUUCAAGUAAUCCAGGAUAGGCUguuuccaucugugaggCCUAUUCUUGAUUACUUGUUUCuggaggcagcu
((((((..(((((..(((((((((.((((((((((..............)))))))))).)))))))))..)))))..))))))

Structure
      gg     UU         C          guuucc 
ggcugu  cugga  CAAGUAAUC AGGAUAGGCU      a
||||||  |||||  ||||||||| ||||||||||       
ucgacg  gguCU  GUUCAUUAG UCUUAUCCgg      u
      ga     UU         U          aguguc 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-26a was cloned from HeLa cells [1]. Two predicted hairpin precursor sequences are present on chromosome 3 (MIR:MI0000083) and 12 (MIR:MI0000750), each with homologues in mouse (MIR:MI0000573 and MIR:MI0000706). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [6].

Genome context
chr12: 57824609-57824692 [-]

Disease association
hsa-mir-26a-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-26a-2 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-26a-2 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-26a-5p

Accession MIMAT0000082
Description Homo sapiens hsa-miR-26a-5p mature miRNA
Sequence 14 - UUCAAGUAAUCCAGGAUAGGCU - 35
Evidence experimental
cloned [2,4-7], Northern [3]
Database links
Predicted targets

Mature hsa-miR-26a-2-3p

Accession MIMAT0004681
Description Homo sapiens hsa-miR-26a-2-3p mature miRNA
Sequence 52 - CCUAUUCUUGAUUACUUGUUUC - 73
Evidence experimental
cloned [6]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  3. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  4. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  5. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  6. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  7. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854