MIR362 is a microRNA (miRNA) that is part of a cluster located within the third intron of the CLCN5 gene on the X chromosome [PMC8253104]. It is regulated by TERT and is known to be involved in various cancer types, acting as an oncomiR [PMC8253104]. Specifically, MIR362 has been implicated in the upregulation of gastric cancer tissues, contributing to increased cell proliferation and resistance to apoptosis [PMC4241533]. It has been observed that certain lung cancer cell lines, such as H1299 and 95-D, express higher levels of MIR362 compared to others like H460 and A549 [PMC6093061]. Furthermore, MIR362 has been identified as a potential regulator of target mRNAs in correlation analysis studies [PMC9097102]'>PMC9097102], and its relationship with target mRNAs has been investigated using inhibitors in BCPAP cells [PMC9097102]. Additionally, MIR362 has been recognized for its role in adipose tissue development and metabolism, with depot-specific effects observed upon Dicer deficiency in mice studies [PMC4892883].
c ACC -A a uugAAUCCUUGGA UAGGUGUG GUgcu u ||||||||||||| |||||||| ||||| u aACUUAGGAACUU AUCCACAC cguga u a --- AA c
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000705 |
Description | Homo sapiens hsa-miR-362-5p mature miRNA |
Sequence | 5 - AAUCCUUGGAACCUAGGUGUGAGU - 28 |
Evidence |
experimental
array-cloned [1], cloned [2-3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004683 |
Description | Homo sapiens hsa-miR-362-3p mature miRNA |
Sequence | 42 - AACACACCUAUUCAAGGAUUCA - 63 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|