MIR365B is a microRNA gene located within the 1.4-Mb NF1 microdeletion region, which is associated with neurofibromatosis type 1 (NF1) [PMC5370280]. This gene, along with MIR193A, is hemizygous in patients with NF1 microdeletions and may contribute to the tumorigenesis observed in these patients [PMC5370280]. Although the role of MIR365B in malignant peripheral nerve sheath tumor (MPNST) pathogenesis is not as well understood as that of SUZ12, it is considered to have putative tumor suppressor functions [PMC5370280]. Research has identified that MIR365B, along with other miRNAs like miR-4262 and miR-506-3p, can target GALNT4 to suppress tumor growth [PMC8504460]. Additionally, POINT-5 analysis has detected significant peaks indicative of Drosha cleavage activity over MIR365B derived from a long noncoding RNA (lncRNA), suggesting its involvement in RNA processing events related to tumorigenesis [PMC8122139]. The presence of MIR365B within the NF1 microdeletion region alongside other genes like ATAD5 and miR193A underscores its potential significance as a tumor suppressor gene within this genomic context [PMC8395254].
agaguguucaa g -- a AC C ----- U u g aca gcaagaa aaugAGGG UUU AGGGGCA GCUG guu u | ||| ||||||| |||||||| ||| ||||||| |||| ||| c ugu cguucuu uUAUUCCU AAA UCCCCGU ugac cag c -----gggcua g ga g -A A AAUac u u
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0022833 |
Description | Homo sapiens hsa-miR-365b-5p mature miRNA |
Sequence | 29 - AGGGACUUUCAGGGGCAGCUGU - 50 |
Evidence |
experimental
454 [5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0022834 |
Description | Homo sapiens hsa-miR-365b-3p mature miRNA |
Sequence | 68 - UAAUGCCCCUAAAAAUCCUUAU - 89 |
Evidence |
experimental
cloned [1,3-4], array-cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|