miRBase entry: hsa-mir-365b

Stem-loop hsa-mir-365b


Accession
MI0000769
Symbol
HGNC: MIR365B
Description
Homo sapiens hsa-mir-365b precursor miRNA mir-365
Gene
family?
RF00659; mir-365

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR365B is a microRNA gene located within the 1.4-Mb NF1 microdeletion region, which is associated with neurofibromatosis type 1 (NF1) [PMC5370280]. This gene, along with MIR193A, is hemizygous in patients with NF1 microdeletions and may contribute to the tumorigenesis observed in these patients [PMC5370280]. Although the role of MIR365B in malignant peripheral nerve sheath tumor (MPNST) pathogenesis is not as well understood as that of SUZ12, it is considered to have putative tumor suppressor functions [PMC5370280]. Research has identified that MIR365B, along with other miRNAs like miR-4262 and miR-506-3p, can target GALNT4 to suppress tumor growth [PMC8504460]. Additionally, POINT-5 analysis has detected significant peaks indicative of Drosha cleavage activity over MIR365B derived from a long noncoding RNA (lncRNA), suggesting its involvement in RNA processing events related to tumorigenesis [PMC8122139]. The presence of MIR365B within the NF1 microdeletion region alongside other genes like ATAD5 and miR193A underscores its potential significance as a tumor suppressor gene within this genomic context [PMC8395254].

Literature search
61 open access papers mention hsa-mir-365b
(319 sentences)

Sequence

83122 reads, 691 reads per million, 133 experiments
agaguguucaaggacagcaagaaaaaugAGGGACUUUCAGGGGCAGCUGUguuuucugacucagucaUAAUGCCCCUAAAAAUCCUUAUuguucuugcagugugcaucggg
...........(.((((((((((.((((((((..(((.(((((((((((.(((....))).)))).....))))))).))).)))))))).)))))))..))).)......

Structure
agaguguucaa g   --       a        AC   C       -----    U   u 
           g aca  gcaagaa aaugAGGG  UUU AGGGGCA     GCUG guu u
           | |||  ||||||| ||||||||  ||| |||||||     |||| |||  
           c ugu  cguucuu uUAUUCCU  AAA UCCCCGU     ugac cag c
-----gggcua g   ga       g        -A   A       AAUac    u   u 


Annotation confidence High
Do you think this miRNA is real?
Comments
Xie et al. [1] refer to this sequence by the internal identifier MIR190. The sequence is unrelated to mammalian mir-190 (MIR:MI0000486).

Genome context
chr17: 31575411-31575521 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-365b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-365b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-365b-5p

Accession MIMAT0022833
Description Homo sapiens hsa-miR-365b-5p mature miRNA
Sequence 29 - AGGGACUUUCAGGGGCAGCUGU - 50
Evidence experimental
454 [5]
Database links
Predicted targets

Mature hsa-miR-365b-3p

Accession MIMAT0022834
Description Homo sapiens hsa-miR-365b-3p mature miRNA
Sequence 68 - UAAUGCCCCUAAAAAUCCUUAU - 89
Evidence experimental
cloned [1,3-4], array-cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 19144710
    Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas
    "Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G"
    "J Virol (2009) 83:3333-3341

  4. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  5. PubMed ID: 15735639
    Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals
    "Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M"
    "Nature (2005) 434:338-345