WARNING: This summary was generated by AI. MIR369 is a microRNA (miRNA) with a notable presence on chromosome 8, playing a significant role in various cellular processes [PMC4203128]. It has been implicated in enhancing the expression of PKM2, which is crucial for cell reprogramming, by stabilizing HNRNPA2B1 [PMC7780020]. Additionally, MIR369 has been shown to inhibit the proliferation and metastasis of hepatocellular carcinoma (HCC) cells by directly targeting ZEB1 [PMC8040887]. It is regulated by FUS3, but it is not explicitly stated to be part of the miR655 miRNA cluster [PMC4162360]. MIR369 also plays a role in enhancing reprogramming efficiency either alone or in combination with other miRNAs and can replace traditional nuclear reprogramming factors [PMC5951134]. It targets genes involved in stomatal movement and grain length regulation and responds to environmental stress such as Cadmium exposure [PMC8233840], [PMC5440550]. High expression of MIR369 is observed in pluripotent embryonic stem cells (ESCs), and this decreases upon differentiation; its coding region retains bivalent chromatin status which can change during ESC differentiation, indicating its involvement in maintaining pluripotency and cellular reprogramming efficiency [PMC4503752].
u a UA cuuua uga gggAGAUCGACCGUGU UAUUCG u ||| |||||||||||||||| |||||| acu uUUUCUAGUUGGUACA AUAAgc u g c UA uucag
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0001621 |
| Description | Homo sapiens hsa-miR-369-5p mature miRNA |
| Sequence | 9 - AGAUCGACCGUGUUAUAUUCG - 29 |
| Evidence |
experimental
cloned [2-4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000721 |
| Description | Homo sapiens hsa-miR-369-3p mature miRNA |
| Sequence | 44 - AAUAAUACAUGGUUGAUCUUU - 64 |
| Evidence |
experimental
cloned [1-4] |
| Database links |
|
| Predicted targets |
|
|