miRBase entry: hsa-mir-370

Stem-loop hsa-mir-370


Accession
MI0000778
Symbol
HGNC: MIR370
Description
Homo sapiens hsa-mir-370 precursor miRNA mir-370
Gene
family?
RF00740; mir-370

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR370 is a microRNA associated with various cancers, including head and neck cancers, and has been implicated in affecting the prognosis of primary central nervous system lymphoma (PCNSL) patients [PMC5354851][PMC9428130[PMC9428130]. It has been shown to enhance gastric cancer (GC) cell proliferation, epithelial-mesenchymal transition (EMT), and invasion by directly downregulating UQCRC2 levels [PMC7378919]. Moreover, MIR370 is involved in the regulation of genes such as Sld5 through the suppression by DNA-methyltransferase1 (DNMT1), which is influenced by interleukin 6 [PMC5885281]. It also has a direct binding effect with MGMT as validated by a dual luciferase reporter assay [PMC5011744]. Interestingly, lncPVT1 can act as a molecular sponge to inhibit MIR370 and promote FOXM1 expression [PMC9373174]. The expression of MIR370 can be suppressed through epigenetic mechanisms such as DNA methylation, which in turn affects the expression of tumor suppression genes [PMC6213964][PMC7381748[PMC7381748]. Additionally, inhibition of MIR370 results in an increase in FoxM1 expression in certain cell lines [PMC3533721], and it is also involved in regulating other genes such as SCD5 through miRNA-mRNA regulatory pairs [PMC7584575]. The levels of MIR370 have been studied in various human lung cancer cell lines to explore its effect on cancer proliferation and metastasis [PMC5675699], highlighting its potential role as a therapeutic target.

Literature search
245 open access papers mention hsa-mir-370
(1482 sentences)

Sequence

35048 reads, 46.0 reads per million, 138 experiments
agacagagaagcCAGGUCACGUCUCUGCAGUUACacagcucacgaguGCCUGCUGGGGUGGAACCUGGUcugucu
((((((....(((((((..((((((.((((...(((.........))).)))).))))))..)))))))))))))

Structure
      agaa       CA      U    UUA   agc 
agacag    gcCAGGU  CGUCUC GCAG   Cac   u
||||||    |||||||  |||||| ||||   |||   c
ucuguc    UGGUCCA  GUGGGG CGUC   Gug   a
      ----       AG      U    --C   agc 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr14: 100911139-100911213 [+]

Disease association
hsa-mir-370 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-370-5p

Accession MIMAT0026483
Description Homo sapiens hsa-miR-370-5p mature miRNA
Sequence 13 - CAGGUCACGUCUCUGCAGUUAC - 34
Evidence experimental
Illumina [4]
Database links
Predicted targets

Mature hsa-miR-370-3p

Accession MIMAT0000722
Description Homo sapiens hsa-miR-370-3p mature miRNA
Sequence 48 - GCCUGCUGGGGUGGAACCUGGU - 69
Evidence experimental
cloned [1-3], Illumina [4]
Database links
Predicted targets

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267

  4. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45