MIR370 is a microRNA associated with various cancers, including head and neck cancers, and has been implicated in affecting the prognosis of primary central nervous system lymphoma (PCNSL) patients [PMC5354851][PMC9428130[PMC9428130]. It has been shown to enhance gastric cancer (GC) cell proliferation, epithelial-mesenchymal transition (EMT), and invasion by directly downregulating UQCRC2 levels [PMC7378919]. Moreover, MIR370 is involved in the regulation of genes such as Sld5 through the suppression by DNA-methyltransferase1 (DNMT1), which is influenced by interleukin 6 [PMC5885281]. It also has a direct binding effect with MGMT as validated by a dual luciferase reporter assay [PMC5011744]. Interestingly, lncPVT1 can act as a molecular sponge to inhibit MIR370 and promote FOXM1 expression [PMC9373174]. The expression of MIR370 can be suppressed through epigenetic mechanisms such as DNA methylation, which in turn affects the expression of tumor suppression genes [PMC6213964][PMC7381748[PMC7381748]. Additionally, inhibition of MIR370 results in an increase in FoxM1 expression in certain cell lines [PMC3533721], and it is also involved in regulating other genes such as SCD5 through miRNA-mRNA regulatory pairs [PMC7584575]. The levels of MIR370 have been studied in various human lung cancer cell lines to explore its effect on cancer proliferation and metastasis [PMC5675699], highlighting its potential role as a therapeutic target.
agaa CA U UUA agc agacag gcCAGGU CGUCUC GCAG Cac u |||||| ||||||| |||||| |||| ||| c ucuguc UGGUCCA GUGGGG CGUC Gug a ---- AG U --C agc
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000722 |
Description | Homo sapiens hsa-miR-370-3p mature miRNA |
Sequence | 48 - GCCUGCUGGGGUGGAACCUGGU - 69 |
Evidence |
experimental
cloned [1-3], Illumina [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0026483 |
Description | Homo sapiens hsa-miR-370-5p mature miRNA |
Sequence | 13 - CAGGUCACGUCUCUGCAGUUAC - 34 |
Evidence |
experimental
Illumina [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|