MIR375 is a microRNA that is specifically expressed in islet cells and is believed to play a role in the early stages of islet development [PMC4700298]. It is particularly involved in the differentiation of embryonic stem cells into liver and insulin secretory cells [PMC4700298]. In the context of post-chemotherapy residual disease, an integrated analysis of miR371 and MIR375 has been proposed to predict the risk of aGCM (acute graft-versus-host disease) and teratoma in patients [PMC8575592]. In certain cases, MIR375, along with WWOX (WW domain containing oxidoreductase), can inhibit autophagy and promote chemosensitivity of cancer cells [PMC8939209]. It has been suggested that PB1 may enhance the function of DC (dendritic cells) by down-regulating MIR375 [PMC5360757]. Furthermore, line chart results have shown that miR-1, miR122, MIR375, and miR-328 exhibit changes in concentration earlier than cardiac troponin I. Additionally, some miRNAs demonstrate more pronounced changes than others [PMC3922900]. Overall, MIR375 has been implicated in various biological processes such as islet development, cancer chemosensitivity modulation, and immune cell function.
c - A CCU C C gac cc cGCG CGAGCC CG ACAAA Cg c || |||| |||||| || ||||| || gg GUGC GCUCGG GC UGUUU gc u c A - CUU U u gag
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000728 |
Description | Homo sapiens hsa-miR-375-3p mature miRNA |
Sequence | 40 - UUUGUUCGUUCGGCUCGCGUGA - 61 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0037313 |
Description | Homo sapiens hsa-miR-375-5p mature miRNA |
Sequence | 5 - GCGACGAGCCCCUCGCACAAACC - 27 |
Evidence | not_experimental |
|