Accession | MIMAT0000728 |
Description | hsa-miR-375-3p mature miRNA |
Hairpins | |
Sequence | UUUGUUCGUUCGGCUCGCGUGA |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
involved_in | GO:0051898 negative regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in CL:0010004 |
involved_in | GO:1903671 negative regulation of sprouting angiogenesis |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:26235810 | occurs_in CL:0002618 |
involved_in | GO:2000353 positive regulation of endothelial cell apoptotic process |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:26235810 | occurs_in CL:0002618 |
located_in | GO:0005615 extracellular space |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:26646931 | part_of UBERON:0001969 |
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|