MIR377, a microRNA, is notably overexpressed in GH, TSH, and PRL adenoma clusters and is implicated in various cellular processes [PMC7652879]. It plays a role in demethylation-induced upregulation of genes like SLIT1 and PRLR in these adenomas [PMC7652879]. MIR377 is also involved in myocardial regeneration and angiogenesis by targeting genes associated with inflammation, oxidative stress, and angiogenesis [PMC7527411]. It demonstrates significant enrichment in heart failure diet groups [PMC7527411] and can regulate metastatic capability by inhibiting epithelial-mesenchymal transition (EMT) and the Wnt/β-catenin pathway [PMC9212183]. In gastric cancer cells, MIR377 affects cell proliferation by altering the cell cycle phases [PMC5795907] and interacts with various genetic elements like NEAT1 pseudogenes and other miRNAs [PMC9730017]. It is among the top upregulated miRNAs after IFN-γ stimulation [PMC8010072] and has been identified as a potential transcriptional repressor of HO-1 protein expression influencing microglial polarization after intracerebral hemorrhage (ICH) prognosis [PMC6109777]. Furthermore, MIR377 expression has been studied for its regulatory relationships with other factors affecting the permeability of the blood-brain barrier (BBB) in glioma-conditioned endothelial cells (GECs) [PMC6180493], while its downregulation has been observed upon treatment with luteolin as validated by qRT-PCR analysis [PMC4791268].
uu C - A - uuu gagcAGAGGUUGCC UUG GUGA UUCg c a |||||||||||||| ||| |||| |||| | u uuUGUUUUCAACGG AAC CACU Aagu g u -g A A - u uau
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004689 |
Description | Homo sapiens hsa-miR-377-5p mature miRNA |
Sequence | 7 - AGAGGUUGCCCUUGGUGAAUUC - 28 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000730 |
Description | Homo sapiens hsa-miR-377-3p mature miRNA |
Sequence | 45 - AUCACACAAAGGCAACUUUUGU - 66 |
Evidence |
experimental
cloned [1-3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|