MIR379 is a member of the δ-like 1 homolog-deiodinase, iodothryonine3 (DLK1-DIO3) cluster and is activated in the epithelial to mesenchymal transition (EMT) of prostate cancer cells [PMC5195822]. It is part of a cluster that includes miR154, miR369, miR376c, miR381, miR382, miR409, and miR410 [PMC10148110]. MIR379 has been studied in various contexts. It has been found to be an imprinted miRNA and a candidate imprinted lncRNA [PMC3743905]. MIR379 levels have been shown to decrease significantly less over time compared to other miRNAs in prostate cancer cells [PMC7486624]. It has also been found to play a role in skeletal muscle differentiation by absorbing other microRNAs such as miR124 [PMC8111742]. In the context of non-alcoholic fatty liver disease (NAFLD), MIR379 levels have been found to correlate positively with ALP, TC, LDL-C and non-HDL-C in early stage patients [PMC9738374]. It has also been proposed as a potential biomarker for diagnosing NAFLD and monitoring disease progression [PMC9738374]. In addition, MIR379 has been shown to regulate target genes involved in various functions related to diabetic nephropathy (DN) [PMC8255808]. Furthermore, computational algorithms predict that MIR379 can bind to the 3' untranslated region of Cyclin B1 mRNA [PMC3707961]. Overall, inhibiting MIR379 may have therapeutic implications for adipose dysfunction and obesity-associated comorbidities such as type 2 diabetes [PMC9535382].
a A GA - uuau agag UGGU GACUAUG ACGUAGG cg g |||| |||| ||||||| ||||||| || ucUC AUCA CUGGUAC UGUAUcc gu a A C AA a cuuu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000733 |
Description | Homo sapiens hsa-miR-379-5p mature miRNA |
Sequence | 6 - UGGUAGACUAUGGAACGUAGG - 26 |
Evidence |
experimental
cloned [2-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004690 |
Description | Homo sapiens hsa-miR-379-3p mature miRNA |
Sequence | 44 - UAUGUAACAUGGUCCACUAACU - 65 |
Evidence |
experimental
cloned [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|