Stem-loop hsa-mir-381

Accession

MI0000789

Symbol

HGNC: MIR381

Description

Homo sapiens hsa-mir-381 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR381 is a microRNA implicated in various biological processes and diseases, including cancer. In gastric cancer cells, MIR381 is involved in significant miRNA regulations, influencing the expression of RNA-binding protein 5 (RBM5) and ubiquitin-specific peptidase 15 (USP15) [PMC4761210]. It has been shown to repress the expression of Bdnf in a RTT-mouse model [PMC8595945] and to interfere with NF-κB signaling by repressing Id1, thereby sensitizing A549/CDDP cells to cisplatin [PMC7211148]. MIR381 also plays a role in prostate cancer by downregulating RELN and AR expression, which inhibits PI3K-AKT-MTOR signaling leading to autophagy and apoptosis induction, as well as suppressing cell proliferation and progression [PMC8939209]. In addition to its role in cancer, MIR381 has been reported to be involved in rat models of renal ischemia reperfusion injury [PMC8484575] and its editing has been promoted the growth of A459 lung cancer cells [PMC8997934]. Despite its significant roles, MIR381 expression was found lower in PANC-1 cells compared with other miRNAs such as MIR767 and MIR182 [PMC3849454], indicating its varied expression across different cell types.

Literature search

72 open access papers mention hsa-mir-381
(408 sentences)

Sequence

11272 reads, 109 reads per million, 108 experiments

uacuuaaAGCGAGGUUGCCCUUUGUAUAUucgguuuauugacauggaaUAUACAAGGGCAAGCUCUCUGUgagua
((((((.((.(((.((((((((.((((((((.((........)).)))))))))))))))).))).)).))))))

Structure

      a  C   G        U        g  uua 
uacuua AG GAG UUGCCCUU GUAUAUuc gu   u
|||||| || ||| |||||||| |||||||| ||    
augagU UC CUC AACGGGAA CAUAUaag ua   u
      G  U   G        -        g  cag 

Annotation confidence High

Genome context

chr14: 101045920-101045994 [+]

Clustered miRNAs

18 other miRNAs are < 10 kb from hsa-mir-381

Disease association

hsa-mir-381 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-381-3p

• Accession: MIMAT0000736
• Description: Homo sapiens hsa-miR-381-3p mature miRNA
• Sequence: 49 - UAUACAAGGGCAAGCUCUCUGU - 70
• Evidence: experimental ; cloned [1-2], SOLiD [3]

Mature hsa-miR-381-5p

• Accession: MIMAT0022862
• Description: Homo sapiens hsa-miR-381-5p mature miRNA
• Sequence: 8 - AGCGAGGUUGCCCUUUGUAUAU - 29
• Evidence: experimental ; SOLiD [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16274478
   Identification of clustered microRNAs using an ab initio prediction method
   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
   BMC Bioinformatics (2005) 6:267


3. PubMed ID: 22282338
   Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs
   "Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F"
   "RNA (2012) 18:472-484