miRBase entry: mmu-mir-382

Stem-loop mmu-mir-382


Accession
MI0000799
Symbol
MGI: Mir382
Description
Mus musculus mmu-mir-382 precursor miRNA

Literature search
28 open access papers mention mmu-mir-382
(227 sentences)

Sequence

236470 reads, 632 reads per million, 95 experiments
uacuugaagaGAAGUUGUUCGUGGUGGAUUCGcuuuacuugugacgaaUCAUUCACGGACAACACUUUUUucagua
((((.(((((((.(((((((((((..(((((((.........).))))))..)))))))))))..)))))))))))

Structure
    u       -A           UG      - uuu 
uacu gaagaGA  GUUGUUCGUGG  GAUUCG c   a
|||| |||||||  |||||||||||  |||||| |   c
auga cuUUUUU  CAACAGGCACU  CUaagc g   u
    -       CA           UA      a ugu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr12: 109733771-109733846 [+]
Clustered miRNAs
18 other miRNAs are < 10 kb from mmu-mir-382
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-382-5p

Accession MIMAT0000747
Description Mus musculus mmu-miR-382-5p mature miRNA
Sequence 11 - GAAGUUGUUCGUGGUGGAUUCG - 32
Evidence experimental
cloned [1-3], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-382-3p

Accession MIMAT0004691
Description Mus musculus mmu-miR-382-3p mature miRNA
Sequence 49 - UCAUUCACGGACAACACUUUUU - 70
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  5. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267