miRBase entry: hsa-mir-330

Stem-loop hsa-mir-330


Accession
MI0000803
Symbol
HGNC: MIR330
Description
Homo sapiens hsa-mir-330 precursor miRNA mir-330
Gene
family?
RF00770; mir-330

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR330 is a microRNA that has been identified as having a negative association with the ALM components TAP1 and TAP2, as well as HLA regulatory factors, suggesting a potential regulatory role in immune responses [PMC8393554]. It is differentially expressed in chronic pancreatitis and pancreatic ductal adenocarcinoma (PDAC), with an overexpression in PDAC compared to an immortalized pancreatic duct model [PMC9599289]. MIR330 is also upregulated in PDAC when compared to pancreatitis [PMC9599289]'>PMC9599289], and alterations in MIR330 have been observed across a significant portion of PDAC patients, indicating its potential as a biomarker for PDAC detection [PMC9599289]. Furthermore, MIR330 has been implicated in the loss of endothelial barrier integrity through its role in the down-regulation of ADAM19 and subsequent decrease of VE-Cadherin [PMC6165832]. It may also contribute to epithelial-mesenchymal transitions (EMT) through the dysregulation of the RKIP network [PMC9600137], and its expression has been observed across various cancer cell lines, suggesting a broader role in cancer biology [PMC8261273]. Additionally, MIR330 may have implications for chronic hepatitis B progression to liver cancer and has been linked with long non-coding RNA SNHG8 through trans-eQTL effects [PMC9946971; PMC7387553]..

Literature search
48 open access papers mention hsa-mir-330
(282 sentences)

Sequence

54219 reads, 127 reads per million, 149 experiments
cuuuggcgaucacugccUCUCUGGGCCUGUGUCUUAGGCucugcaagaucaaccgaGCAAAGCACACGGCCUGCAGAGAggcagcgcucugccc
....(((((.(.(((((((((((((((((((.(((..((((.............)))).))))))).))))..))))))))))).).)).))).

Structure
cuuu   -  u a           --    -    U   AG    ugcaa 
    ggc ga c cugccUCUCUG  GGCC UGUG CUU  GCuc     g
    ||| || | |||||||||||  |||| |||| |||  ||||     a
    ccg cu g gacggAGAGAC  CCGG ACAC GAA  CGag     u
---c   u  c c           GU    C    -   -A    ccaac 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3].

Genome context
chr19: 45638994-45639087 [-]

Database links

Mature hsa-miR-330-5p

Accession MIMAT0004693
Description Homo sapiens hsa-miR-330-5p mature miRNA
Sequence 18 - UCUCUGGGCCUGUGUCUUAGGC - 39
Evidence experimental
cloned [3-4]
Database links
Predicted targets

Mature hsa-miR-330-3p

Accession MIMAT0000751
Description Homo sapiens hsa-miR-330-3p mature miRNA
Sequence 57 - GCAAAGCACACGGCCUGCAGAGA - 79
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  4. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365