MIR330 is a microRNA that has been studied in various contexts. It has been found to be negatively associated with certain ALM components and HLA regulatory factors, such as TAP1, TAP2, CIITA, NLRC5, IRF1, and IRF8 [PMC8393554]. In the context of pancreatic diseases, MIR330 has shown differential expression between chronic pancreatitis patients and pancreatic ductal adenocarcinoma (PDAC) patients [PMC9599289]. It is upregulated in PDAC compared to immortalized pancreatic duct models [PMC9599289]. MIR330 is also associated with alterations in PDAC patients and may be a potential marker for PDAC detection [PMC9599289]. In the context of S. aureus infection, MIR330 expression increases rapidly and contributes to the loss of barrier integrity through down-regulation of ADAM19 and VE-Cadherin [PMC6165832]. The downregulation of MIR330 may also sustain epithelial-mesenchymal transition (EMT) through dysregulation of the RKIP network [PMC9600137]. Additionally, MIR330 has been observed in breast cancer cell lines and is associated with the regulation of target genes in luminal-A subtypes [PMC8261273]. It may also play a role in liver cancer development for chronic hepatitis B patients [PMC9946971]. Furthermore, MIR330 has been implicated in post-myocardial infarction heart failure (HF) and may be a candidate biomarker for HF progression after myocardial infarction [PMC8687817]. It has also shown potential therapeutic effects in acute coronary syndrome by suppressing plaque formation through the WNT signaling pathway [PMC8687817] and stable carotid plaques by targeting Talin-1 in symptomatic carotid stenosis patients [PMC8687817]. Additionally, MIR330 has been shown to inhibit oxidative stress damage in Alzheimer's disease mice and alleviate mitochondrial dysfunction [PMC7249309].
cuuu - u a -- - U AG ugcaa ggc ga c cugccUCUCUG GGCC UGUG CUU GCuc g ||| || | ||||||||||| |||| |||| ||| |||| a ccg cu g gacggAGAGAC CCGG ACAC GAA CGag u ---c u c c GU C - -A ccaac
Accession | MIMAT0004693 |
Description | Homo sapiens hsa-miR-330-5p mature miRNA |
Sequence | 18 - UCUCUGGGCCUGUGUCUUAGGC - 39 |
Evidence |
experimental
cloned [3-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000751 |
Description | Homo sapiens hsa-miR-330-3p mature miRNA |
Sequence | 57 - GCAAAGCACACGGCCUGCAGAGA - 79 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|