MIR330 is a microRNA that has been identified as having a negative association with the ALM components TAP1 and TAP2, as well as HLA regulatory factors, suggesting a potential regulatory role in immune responses [PMC8393554]. It is differentially expressed in chronic pancreatitis and pancreatic ductal adenocarcinoma (PDAC), with an overexpression in PDAC compared to an immortalized pancreatic duct model [PMC9599289]. MIR330 is also upregulated in PDAC when compared to pancreatitis [PMC9599289]'>PMC9599289], and alterations in MIR330 have been observed across a significant portion of PDAC patients, indicating its potential as a biomarker for PDAC detection [PMC9599289]. Furthermore, MIR330 has been implicated in the loss of endothelial barrier integrity through its role in the down-regulation of ADAM19 and subsequent decrease of VE-Cadherin [PMC6165832]. It may also contribute to epithelial-mesenchymal transitions (EMT) through the dysregulation of the RKIP network [PMC9600137], and its expression has been observed across various cancer cell lines, suggesting a broader role in cancer biology [PMC8261273]. Additionally, MIR330 may have implications for chronic hepatitis B progression to liver cancer and has been linked with long non-coding RNA SNHG8 through trans-eQTL effects [PMC9946971; PMC7387553]..
cuuu - u a -- - U AG ugcaa ggc ga c cugccUCUCUG GGCC UGUG CUU GCuc g ||| || | ||||||||||| |||| |||| ||| |||| a ccg cu g gacggAGAGAC CCGG ACAC GAA CGag u ---c u c c GU C - -A ccaac
Accession | MIMAT0004693 |
Description | Homo sapiens hsa-miR-330-5p mature miRNA |
Sequence | 18 - UCUCUGGGCCUGUGUCUUAGGC - 39 |
Evidence |
experimental
cloned [3-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000751 |
Description | Homo sapiens hsa-miR-330-3p mature miRNA |
Sequence | 57 - GCAAAGCACACGGCCUGCAGAGA - 79 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|