miRBase entry: hsa-mir-135b

Stem-loop hsa-mir-135b


Accession
MI0000810
Symbol
HGNC: MIR135B
Description
Homo sapiens hsa-mir-135b precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR135B, a microRNA, was found to be downregulated in PWS INS-1 cell lines, alongside Mir3065 and Mir212 [PMC10138222]. This downregulation was observed despite the absence of differentially expressed genes (DEGs) in the RNA-seq data for predicted targets [PMC10138222]. In a separate study, MIR135B has been implicated in the regulation of the adenomatous polyposis coli (APC) gene by binding to its 3’UTR transcript [PMC3843547]. This interaction influences APC mRNA levels and thus modulates the Wnt signaling pathway, which is crucial for cell proliferation control [PMC3843547].

Literature search
190 open access papers mention hsa-mir-135b
(898 sentences)

Sequence

4823 reads, 33 reads per million, 76 experiments
cacucugcuguggccUAUGGCUUUUCAUUCCUAUGUGAuugcugucccaaacucAUGUAGGGCUAAAAGCCAUGGGcuacagugaggggcgagcucc
..(((((((((((((((((((((((...(((((((((((((......)))..))))))))))..))))))))))))))))))).)))).........

Structure
-------ca    -                   CAU          --   cu 
         cucu gcuguggccUAUGGCUUUU   UCCUAUGUGA  uug  g
         |||| |||||||||||||||||||   ||||||||||  |||   
         ggga ugacaucGGGUACCGAAAA   GGGAUGUAcu  aac  u
ccucgagcg    g                   -UC          ca   cc 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3].

Genome context
chr1: 205448302-205448398 [-]

Disease association
hsa-mir-135b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-135b-5p

Accession MIMAT0000758
Description Homo sapiens hsa-miR-135b-5p mature miRNA
Sequence 16 - UAUGGCUUUUCAUUCCUAUGUGA - 38
Evidence experimental
cloned [3-4]
Database links
Predicted targets

Mature hsa-miR-135b-3p

Accession MIMAT0004698
Description Homo sapiens hsa-miR-135b-3p mature miRNA
Sequence 55 - AUGUAGGGCUAAAAGCCAUGGG - 76
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  4. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365