WARNING: This summary was generated by AI. MIR135B, a microRNA, was found to be downregulated in PWS INS-1 cell lines, alongside Mir3065 and Mir212 [PMC10138222]. This downregulation was observed despite the absence of differentially expressed genes (DEGs) in the RNA-seq data for predicted targets [PMC10138222]. In a separate study, MIR135B has been implicated in the regulation of the adenomatous polyposis coli (APC) gene by binding to its 3’UTR transcript [PMC3843547]. This interaction influences APC mRNA levels and thus modulates the Wnt signaling pathway, which is crucial for cell proliferation control [PMC3843547].
-------ca - CAU -- cu
cucu gcuguggccUAUGGCUUUU UCCUAUGUGA uug g
|||| ||||||||||||||||||| |||||||||| |||
ggga ugacaucGGGUACCGAAAA GGGAUGUAcu aac u
ccucgagcg g -UC ca cc
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000758 |
| Description | Homo sapiens hsa-miR-135b-5p mature miRNA |
| Sequence | 16 - UAUGGCUUUUCAUUCCUAUGUGA - 38 |
| Evidence |
experimental
cloned [3-4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004698 |
| Description | Homo sapiens hsa-miR-135b-3p mature miRNA |
| Sequence | 55 - AUGUAGGGCUAAAAGCCAUGGG - 76 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
|